A toy rocket is launched from a 1.4 m high platform in such a way that its height, h (in meters), after t seconds is given by the equation
h= -4.9t² +9.1t+1.4. How long will it take for the rocket to hit the ground?

Answers

Answer 1
h=-4.9t²+9.1t+1.4
sub h=1.4
1.4=-4.9t²+9.1t+1.4
-4.9t²+9.1t=0
now factorise the equation
(t-13/7)(t)=0
t=13/7 or
t=0(reject, t must be >0)

Therefore, t=13/7s
Answer 2

The rocket will take 2 seconds for the rocket to hit the ground.

We have,

To find the time it takes for the rocket to hit the ground, we need to determine when the height, h, becomes zero (since the ground is at height zero).

Given the equation for the height of the rocket at time t:

h = -4.9t² + 9.1t + 1.4, we can set h to zero and solve for t:

0 = -4.9t² + 9.1t + 1.4

This is a quadratic equation in the form of at² + bt + c = 0,

where a = -4.9, b = 9.1, and c = 1.4.

To solve for t, we can use the quadratic formula:

t = (-b ± √(b² - 4ac)) / 2a

Substituting the values:

t = (-(9.1) ± √((9.1)² - 4(-4.9)(1.4))) / 2(-4.9)

t = (-9.1 ± √(82.81 + 27.44)) / (-9.8)

t = (-9.1 ± √110.25) / (-9.8)

Now, we have two possible solutions for t:

t₁ = (-9.1 + √110.25) / (-9.8)

t₂ = (-9.1 - √110.25) / (-9.8)

Calculating these values:

t₁ ≈ -0.143

t₂ ≈ 2

Since time cannot be negative, the only meaningful solution is t₂ ≈ 2 seconds.

Thus,

The rocket will take 2 seconds for the rocket to hit the ground.

Learn more about equations here:

https://brainly.com/question/17194269

#SPJ7


Related Questions

Which of the following describe the growth rate of the exponential function in the graph below?

Which of the following describe the growth rate of the exponential function in the graph below?

Answers

Answer:

B)

Step-by-step explanation:

Let's check each answer:

A is incorrect. If that were the case, (0,1) to (1,3) would be (0,1) to (1,5) instead

B is correct. The y-coordinate gets multiplied by 3 each time (0,1)->(1,1*3)->(2,3*3)->(4,3*3*3)

C is incorrect. If that were the case, (1,3) to (2,9) would be (1,3) to (2,7) instead.

D is incorrect. If that were the case, (0,1) to (1,3) would be (0,1) to (1,4) instead.

Therefore, the correct answer is B.

Answer:

Its B :)

Step-by-step explanation:

I j took the unit quiz lol

A website sells a dress at £20 and shoes at £25. The website has an offer: Buy a dress and shoes together and get 1 3 off the price. There is also a shipping and handling charge of £4 added at the end, after any discount. If Ruth buys both a dress and shoes, how much will she actually pay?

Answers

£36

20+25=45          Take away 13 and it's 32.   32+4 (the shipping charge) is 36. So Ruth pays 36 pounds.

<<
<
Choose the correct symbol for interval notation when a value is to be included in the solution

Answers

Answer:

>

Step-by-step explanation:

let me know if it's wrong

Slove each inequality and graph it’s solution. (the sign has a line under it but I can’t do it on my keyboard)
|5a| > 10

Answers

La gente que no ha sido un problema que han dicho nada

Y= -(x-3)2 +4
Minimum or minimum

Answers

The maximum value of the quadratic function is (3,4).

The given quadratic function is \(y = - (x -3)^{2} +4\)

So, \(y = - (x -3)^{2} +4\)

Expanding the function, we get,

\(y = - ( x^{2} +9 - 6x) +4\\\\y = -x^{2} - 9 +6x +4\\\\y = -x^{2} +6x -5\\\\\)

Comparing this equation with the general equation \(ax^{2} +bx+c\)

we get, a = -1, b = 6 and c = -5

The maximum of a quadratic function occurs at  \(x = \frac{-b}{2a}\)

So, putting these values in the formula, we get:

\(x = \frac{-6}{2(-1)} =\frac{-6}{-2} = 3\)

Hence, the maximum value is 3.

Now, evaluating y when x = 3, we get

y = 4.

Hence, the point at which the given function has maximum value is (3,4)

To read more about quadratic functions, visit https://brainly.com/question/17177510

#SPJ1

o
Decrease 40 by ratio of 4:5

Answers

A decrease in the ratio 4:5 implies that :

New quantity:Old quantity = 4:5

Let the new quantity be \( \bf \: x\)

\( \bf∴ x : 40 = 4:5\)

\( = > \bf \frac{x}{40} = \frac{4}{5} \)

\( \bf = > 40 \times \frac{x}{40} = 40 \times \frac{4}{5} \)

\( \bf = > x = 8 \times 4\)

\( \bf = > x = 32\)

So, the new quantity is 32

3. In Mexico a lawyer is using a relatively small-scale (1:100,000) to locate an abandoned oil well on a client's property for legal purposes. He is having a difficult time finding this old we because it is overgrown with brush. Assuming that 90% of the points will be within 5 mm of their actual position on the map calculate the relative accuracy of features plotted on this map meters. Show your work to get credit.

Answers

Therefore, the relative accuracy of features plotted on the map is 500 meters.

To calculate the relative accuracy of features plotted on the map in meters, we need to convert the given accuracy from millimeters to meters.

Given:

Relative accuracy = 90%

Accuracy within 5 mm

To convert millimeters to meters, we divide by 1000:

5 mm = 5/1000 = 0.005 meters

Relative accuracy can be defined as the ratio of the actual accuracy to the map scale. In this case, the map scale is given as 1:100,000, which means that one unit on the map represents 100,000 units in reality.

To calculate the relative accuracy in meters, we multiply the actual accuracy (0.005 meters) by the map scale (100,000):

Relative accuracy = 0.005 meters * 100,000 = 500 meters

To know more about relative accuracy,

https://brainly.com/question/32502032

#SPJ11

The International Business Club starts the school year with $250.50 in their account. They spend $35 each month on activities. The Future Agricultural Leaders Club starts with $300 and spends $45.25 each month. Which equation can be used to find m, the number of months it will take for both accounts to have the same amount of money? 250.5 + 35m = 300 + 45.25m 250.5 – 35m = 300 – 45.25m 250.5m – 35 = 300m – 45.25 250.5m + 35 = 300m + 45.25

Answers

Answer:

250.50 - 35m = 300 - 45.25m

Step-by-step explanation:

Whenever an equation asks for when it will take x (or m in this case) amount of things or time you should know that there will be 2 different equations that have to equal each other

The equation will be 250.50 - 35m = 300 - 45.25m

The 35m is being subtracted from 250.50 because they are losing money each time they spend. This also applies to 45.25m

Also 35m and 45.25m are variables because it says they spend that much money each month. They don't specify how many months, so we have to put a variable after it.

Answer:

b) 250.5 – 35m = 300 – 45.25m

Step-by-step explanation:

on edge 2020 || pls mark brainliest

Evaluate: 3(2f - g) + 4h for f = 2, g = -1 and h = 3

Answers

Answer:

27

Step-by-step explanation:

6f - 3g + 4h

6(2) - 3(-1) + 4(3)

12 + 3 + 12

27

Answer:

Step-by-step explanation:

3(2(2)  + 1 ) + 4(3)

3(4 + 1) + 12

3(5) + 12

15 + 12

27

2
y
b
P
0
The equation of the line / in the diagram is y = 5-x.
The line cuts the y-axis at P.
a
Write down the co-ordinates of P.
Write down the gradient of the line 1.
NOT TO
SCALE

Answers

Given that the equation of the line in the diagram is `y = 5 - x`. The line cuts the y-axis at P. So, the coordinates of point P are (0,5) and the gradient of the line is `-1`.

The equation of the line can be written as `y = -1x + 5`.Therefore, the y-intercept of the line is 5. Therefore, the coordinates of point P are (0,5).

To find the gradient of the line, we have to write the equation of the line in the form of `y = mx + c`.

We can rewrite `y = -1x + 5` as `y = (-1)x + 5`.From the above form of the equation, we can see that the gradient `m` is `-1`.Therefore, the gradient of line 1 is `-1`.Hence, the required answer is: Coordinates of point P is `(0,5)`.The gradient of the line is `-1`.

For more questions on: gradient

https://brainly.com/question/29578324

#SPJ8    

HELP ASAP HURRY WILL MARK BRAINLIEST ID CORRECT

HELP ASAP HURRY WILL MARK BRAINLIEST ID CORRECT

Answers

Answer:

a

Step-by-step explanation:

Answer:

a. a student who was not absent during unit should score about 98

In city A, the temperature rises 9° F from 8am then the temperature drops 8°F from 9am to 10am in city B the temperature drops 1°F from 8am to 9am then the temperature drops 3°F from 9am to 10am write an expression that represents the change In temperature from 8am to 10am for each city. Simplify and interpret each sum. Which expression represents the change in temperature for city A?

In city A, the temperature rises 9 F from 8am then the temperature drops 8F from 9am to 10am in city

Answers

Answer:

For City A, the expression for temperature change is 9 + (-8)

The amount the temperature changes for City A = 1°F

For City B, the expression for temperature change is -1 + (-3) = -4°F

The amount the temperature changes for City B = -4°F

Step-by-step explanation:

The given information are;

In City A, the temperature rise from 8 am to  9 am = 9°F

In City A, the temperature drop from 9 am to  10 am = 8°F

In City B, the temperature drop from 8 am to  9 am = 1°F

In City B, the temperature drop from 9 am to  10 am = 3°F

The expression for that represents the temperature change from 8 am to 10 am is therefore;

For City A

Temperature change from 8 am to 10 am are

8 am to  9 am = +9°F

9 am to  10 am = -8°F

Sum, change from 8 am to 10 am = 9 + (-8) = 1°F

For City B

Temperature change from 8 am to 10 am are

8 am to  9 am = -1°F

9 am to  10 am = -3°F

Sum, change from 8 am to 10 am = -1 + (-3) = -4°F

Please help im confused.

Please help im confused.

Answers

Answer:

The first choice is the answer.

Step-by-step explanation:

what is the volume of the solid generated when the region in the first quadrant bounded by the graph of y

Answers

The volume of the solid generated when the region in the first quadrant is: V ≈ 183.78

Volume of Solid Revolution:

The disc method, the shell method, and Pappus' centroid theorem can all be used to calculate volume. In many academic disciplines, such as engineering, medical imaging, and geometry, revolution volumes are used. Integration can be used to determine the area of a region bounded by a known curve.

Because we are only revolving the region in the first quadrant, the x values range from x = 0 to x = 3.

Because of the rotation is about the vertical line x = -1, the radius of the cylindrical shell at x is r = x + 1.

The height of the cylindrical shell at x is h = \(x^{2}\)

We can now create our integral equation to find the volume:

\(V =2\pi\int\limits^a_b {rh} \, dx =2\pi\int\limits^3_0 {(1+x)x^2} \, dx \\\\V =2\pi\int\limits^3_0 {(x^{2} +x^3)} \, dx\)

We can now integrate and evaluate to find the volume of the solid.

\(V=2\pi(\frac{x^3}{3}+\frac{x^4}{4} )|^3_0\\\\V = 2\pi(\frac{27}{3}+\frac{81}{4} )\\\\V=\frac{117\pi}{2}\)

V ≈ 183.78

Learn more about Volume of the solid at:

https://brainly.com/question/30465757

#SPJ4

The given question is incomplete, complete question is:

Find the volume of the solid generated by revolving the region in the first quadrant bounded above by the curve y =\(x^{2}\), below by the x-axis, and on the right by the line x = 3, about the line x = −1

If y=a^n; then change in y/y= n(change in a/a)

Answers

So the final expression is: (change in y/y) = n (change in a/a).

We can start by taking the natural logarithm of both sides of the equation:

ln(y) = ln(aⁿ)

Using the rule that ln(aⁿ) = n ln(a), we can simplify this to:

ln(y) = n ln(a)

Next, we can take the derivative of both sides with respect to a:

d/d(a) ln(y) = d/d(a) (n ln(a))

Using the chain rule, we can simplify the right-hand side to:

d/d(a) ln(y) = n (1/a)

Now, we can multiply both sides by a/y:

a/y * d/d(a) y = n(a/y) * (1/a)

Simplifying, we get:

dy/y = n da/a

To know more about derivative,

https://brainly.com/question/25324584

#SPJ11

For a population with µ = 80 and σ = 20, the distribution of sample means based on n = 16 will have an expected value of __________

Answers

Answer:

calculate the number of atom in 3 mol helium

Lamia has the letter cards A, Z, D, Y, and E in a bag. If she selects a permutation of the cards at random, what is the probability that she will spell the word "ZAYED”?

Answers

Answer:

\(\displaystyle \frac{1}{5!} = \frac{1}{120} \approx 0.00833\).

Step-by-step explanation:

Note that all five letters here are distinct (i.e., none of them is repeated.) There are \(\displaystyle P(5,\, 5) = \frac{5!}{(5 - 5)!} = 5! = 120\) ways to arrange five distinct items (where the order of the arrangement matters.)

The reason is that there are five choices for the first item, four choices for the second item, three choices for the third item, etc. Hence, the numerator is \(5 \times 4\times 3 \times 2 \times 1\), which is the same as \(5!\). On the other hand, since there's only one way to choose five items out of five (i.e., to select them all,) the denominator would be \(1\).

Note that the \(\verb!ZAYED!\) is just one of that \(5!\) possible permutations. If the cards are arranged in random, all these permutations ought to have an equal probability. Therefore:

\(\begin{aligned}& P(\verb!ZAYED!) \\ &= \frac{\text{Number of permutations that gives $\texttt{ZAYED}$}}{\text{Number of all permutations involved}} \\ &= \frac{1}{5!} = \frac{1}{120} \approx 0.00833\end{aligned}\).

At what value(s) of x does fx) x4-18x2 have a critical point where the graph changes from decreasing to increasing? (4 points) 0 and -3 only 0 and 3 only 0 -3, and 3 only 0 only DELL

Answers

The correct answer is: 0, -3, and 3. At  0, -3, and 3 of x does fx) x4-18x2 have a critical point where the graph changes from decreasing to increasing.

To find the critical points where the graph of the function f(x) = x^4 - 18x^2 changes from decreasing to increasing, we need to find the values of x where the derivative of the function is equal to zero or does not exist.

Let's find the derivative of f(x) with respect to x:

f'(x) = 4x^3 - 36x

To find the critical points, we set the derivative equal to zero and solve for x:

4x^3 - 36x = 0

Factor out 4x:

4x(x^2 - 9) = 0

Now we have two factors:

1) 4x = 0, which gives x = 0

2) x^2 - 9 = 0, which gives x = ±3

So, the critical points where the graph changes from decreasing to increasing are x = 0, x = -3, and x = 3.

Therefore, the correct answer is: 0, -3, and 3.

Visit here to learn more about graph brainly.com/question/17267403
#SPJ11

Bryan earns $5. 00 per lawn mowed and $5. 00 per car wash. Let m be the number of lawns mowed and let c be the mumber of cars washed. Select all the expressions that could represent the total earned, E in dollars, by Bryan?


Please need help and steps

Answers

The expression 5m + 5c represents the total amount earned by Bryan, where "m" is the number of lawns mowed and "c" is the number of cars washed.

To calculate the total amount earned by Bryan, we need to consider the earnings from both mowing lawns and washing cars.

The expression that represents the total earned by Bryan is given by:

E = (earnings from mowing lawns) + (earnings from washing cars)

Since Bryan earns $5.00 per lawn mowed and $5.00 per car wash, the expression can be written as:

E = 5m + 5c

Here, "m" represents the number of lawns mowed and "c" represents the number of cars washed.

To find the total earned, simply substitute the values of "m" and "c" into the expression and calculate the result. For example, if Bryan mows 3 lawns and washes 2 cars, the total earned would be:

E = 5(3) + 5(2)

= 15 + 10

= $25.00

Know more about the total amount earned

https://brainly.com/question/26214860

#SPJ11

find the curve in the xy-plane that passes through the point (4,9) and whose slope at each point is 3sqrt(x)

Answers

The curve in the xy-plane that passes through the point (4,9) and whose slope at each point is 3sqrt(x) is y = 2(x^(3/2) - 8) + 9.

To find the curve in the xy-plane that passes through the point (4,9) and whose slope at each point is 3sqrt(x), we need to integrate the slope function with respect to x to get the equation of the curve.

∫dy/dx dx = ∫3sqrt(x) dx

Integrating both sides, we get:

y = 2x^(3/2) + C

where C is the constant of integration. To find C, we use the point (4,9) that the curve passes through:

9 = 2(4)^(3/2) + C

C = 9 - 2(4)^(3/2)

So the equation of the curve is:

y = 2x^(3/2) + 9 - 2(4)^(3/2)

Simplifying, we get:

y = 2(x^(3/2) - 8) + 9

Therefore, the curve in the xy-plane that passes through the point (4,9) and whose slope at each point is 3sqrt(x) is y = 2(x^(3/2) - 8) + 9.

Learn more about xy-plane here

https://brainly.com/question/30881622

#SPJ11

a) A circular channel section has diameter of 6m and it is running half. Calculate the discharge through the channel if the bed slope is 1 in 600 and manning’s co efficient is equal to 0.014.

Answers

To calculate the discharge through the circular channel, we can use Manning's equation, which relates the flow rate (Q) to the channel properties and flow conditions. Manning's equation is given by:

Q = (1/n) * A * R^(2/3) * S^(1/2)

where:

Q is the discharge (flow rate)

n is Manning's coefficient (0.014 in this case)

A is the cross-sectional area of the channel

R is the hydraulic radius of the channel

S is the slope of the channel bed

First, let's calculate the cross-sectional area (A) of the circular channel. The diameter of the channel is given as 6m, so the radius (r) is half of that, which is 3m. Therefore, the area can be calculated as:

A = π * r^2 = π * (3m)^2 = 9π m^2

Next, let's calculate the hydraulic radius (R) of the channel. For a circular channel, the hydraulic radius is equal to half of the diameter, which is:

R = r = 3m

Now, we can calculate the slope (S) of the channel bed. The given slope is 1 in 600, which means for every 600 units of horizontal distance, there is a 1-unit change in vertical distance. Therefore, the slope can be expressed as:

S = 1/600

Finally, we can substitute these values into Manning's equation to calculate the discharge (Q):

Q = (1/0.014) * (9π m^2) * (3m)^(2/3) * (1/600)^(1/2)

Using a calculator, the discharge can be evaluated to get the final result.

To learn more about coefficient : brainly.com/question/1594145

#SPJ11

8) A dress normally sells for $35.85. How much does the dress cost after a 15% discount??​

Answers

Answer:

$30.47

Step-by-step explanation:

100%-15%=85%
85%=0.85
$35.85*0.85=30.47 (to 2d.p)
Hope this helps

Your grandmother has been putting $5,000 into a savings account on every birthday since your first that is, when you turned one). The account pays an interest rate of 7% How much money will be in the account medialty after your grandmother makes the deposit on your 18th birthday The amount in the account upon your 18th birthday is (Round to the nearest dollar)

Answers

After your grandmother makes a $5,000 deposit on your 18th birthday, the amount in the savings account can be calculated using compound interest. Assuming the account pays an interest rate of 7%, the amount in the account immediately after the deposit can be determined by applying the compound interest formula.

To calculate the amount in the savings account after the deposit on your 18th birthday, we can use the compound interest formula: A = P(1 + r/n)^(nt), where A represents the final amount, P is the principal (initial deposit), r is the interest rate, n is the number of times interest is compounded per year, and t is the number of years.

In this case, the initial deposit is $5,000, the interest rate is 7% (or 0.07 as a decimal), and the deposit is made on your 18th birthday, which means the time is 17 years. Since no information is given about the compounding frequency, let's assume it is compounded annually (n = 1).

Plugging in the values into the compound interest formula, we have A = 5000(1 + 0.07/1)^(1*17) = 5000(1.07)^17 ≈ $15,128.

Therefore, the amount in the savings account immediately after your grandmother makes the deposit on your 18th birthday is approximately $15,128, rounded to the nearest dollar.

Learn more about compound interest here:

https://brainly.com/question/13155407

#SPJ11

Assume that a medical research study found a correlation of -0.73 between consumption of vitamin A and the cancer rate of a particular type of cancer. This could be interpreted to mean:
a. the more vitamin A consumed, the lower a person's chances are of getting this type of cancer
b. the more vitamin A consumed, the higher a person's chances are of getting this type of cancer
c. vitamin A causes this type of cancer

Answers

The negative correlation coefficient of -0.73 between consumption of vitamin A and the cancer rate of a particular type of cancer suggests that as vitamin A consumption increases, the cancer rate tends to decrease.

A correlation coefficient measures the strength and direction of the linear relationship between two variables.

In this case, a correlation coefficient of -0.73 indicates a negative correlation between consumption of vitamin A and the cancer rate.

Interpreting this correlation, it can be inferred that there is an inverse relationship between the two variables. As consumption of vitamin A increases, the cancer rate tends to decrease.

However, it is important to note that correlation does not imply causation.

It would be incorrect to conclude that consuming more vitamin A causes this type of cancer. Correlation does not provide information about the direction of causality.

Other factors and confounding variables may be involved in the relationship between vitamin A consumption and cancer rate.

To establish a causal relationship, further research, such as experimental studies or controlled trials, would be necessary. These types of studies can help determine whether there is a causal link between vitamin A consumption and the occurrence of this particular cancer.

Learn more about correlation coefficient here:

https://brainly.com/question/29208602

#SPJ11

TRUE/FALSE When inserting a value into a partially-filled array, in descending order, the insertion position is the index of the first value smaller than the value.

Answers

The given statement When inserting a value into a partially-filled array in descending order, the insertion position is indeed the index of the first value smaller than the value being inserted is true.

What is partially filled array?

A partially filled array, also known as a sparse array, is an array data structure where not all elements are populated with values. In other words, it is an array that contains empty or uninitialized elements.

When inserting a new value into this sorted array, we start from the beginning and compare the value with each existing element until we find the first element that is smaller. The insertion position for the new value is the index of this first smaller element.

For example, if we have a partially-filled array [10, 8, 5, 3] and we want to insert the value 6 into the array in descending order, we compare 6 with each element from left to right. The first element smaller than 6 is 5, and its index is 2. Therefore, the insertion position for the value 6 would be index 2, resulting in the updated array [10, 8, 6, 5, 3].

Learn more about partially filled array here:

https://brainly.com/question/6952886

#SPJ4

find measure of MK in the image below

Answers

Answer:

ok is the corr!ctewwwdeeecceeeeecrrr\g

1-x/11 \(1-x/11 =6\\\)=6

Answers

Given:

Consider the equation is:

\(\dfrac{1-x}{11}=6\)

To find:

The value of x.

Solution:

We have,

\(\dfrac{1-x}{11}=6\)

After multiplying both sides by 11, we get

\(1-x=66\)

\(-x=66-1\)

\(-x=65\)

Multiply both sides by -1.

\(x=-65\)

Therefore, the value of x is -65.

Solve for x and y simultaneously if:
x+4=2y and y2-xy+21=0

Answers

Answer:

Step-by-step explanation:

x=−10, y=−3

x=10, y=7

y=7,x=10

y=−3,x=−10

Thomas bought 120 whistles, 168 yo-yos and 192 tops. He packed an equal amount of items in each bag. A) What is the maximum number of bag that he can get?

Answers

Thomas can pack the items into a maximum of 20 bags, with each bag containing 24 items after calculated with greatest common divisor.

To find the maximum number of bags Thomas can pack, we need to find the greatest common divisor (GCD) of 120, 168, and 192. The GCD will represent the maximum number of items that can be packed into each bag.

To find the GCD, we can use the Euclidean algorithm. First, we find the GCD of 120 and 168:

168 = 1 * 120 + 48

120 = 2 * 48 + 24

48 = 2 * 24 + 0

Therefore, the GCD of 120 and 168 is 24.

Next, we find the GCD of 24 and 192:192 = 8 * 24 + 0

Therefore, the GCD of 120, 168, and 192 is 24.

So, Thomas can pack 24 items into each bag. To find the maximum number of bags he can get, we divide the total number of items by 24:

Total number of items = 120 + 168 + 192 = 480

Number of bags = 480 / 24 = 20

Therefore, Thomas can get a maximum of 20 bags.

To learn more about Euclidean algorithm Click here:
brainly.com/question/13266751

#SPJ4

I don’t know how to solve for x or y, I’m knew to this and CANT remember the formula

I dont know how to solve for x or y, Im knew to this and CANT remember the formula

Answers

Answer:

\( \frac{6}{x} = \frac{8}{24} \)

\(8x = 144\)

\(x = 18\)

\( \frac{8}{24} = \frac{y}{12} \)

\(24y = 96\)

\(y = 4\)

So x = 18 and y = 4.

Other Questions
Shea works in a lab. It takes Shea 30 minutes to calibrate her lab instrument. If she calibrated it 5 times last month, how many hours did she spend calibrating it? .What decimal is being represented by the decimal grid? Question: Assume you have a balance of $1000 on a credit card with an APR of 12%, or 1% per month. You start making monthly paymentsof $200, but at the same time you charge an additional $100 per month to the credit card. Assume that interest for a given month is based onthe balance for the previous month. The following table shows how you can calculate your monthly balance. Complete and extend the table toshow the balance at the end of each month until the debt is paid off. How long does it take to pay off the credit carddebt?ntsFill out the table row by row and continue until the last full payment. Round to the nearest cent as needed.MonthPaymentExpensesInterestNew Balanceaurces0---$1000es1$200$100$10$9104/7fing2$200$100ection3$200$1004$200$100 The unshaded regions are quarter circles. Which choice best approximates the area of the shaded region? Use 3.14. According to Erikson, a major determinant of self-esteem is a child's view of his or her capacity toA. be liked.B. not feel guilty when initiating an action.C. complete productive work.D. form relationships. Consider the graph of the function f(x)=10^x. What is the range of function g if g(x)=-2f(x)+1?A. (-infinity, 1)B. (-2, infinity) C. (-infinity, 2) D. (0, infinity) Hi can you please guide me through the steps to solve this problem? can you please compare the DNA sequences in thisimage, mark any insertion, deletion, polymorphism, and addition.Discuss about the yellow region in sequences and the nucleotides.discuss all the simi>M12-LCMT-F_D02.ab1TAAAGCCATTTACCGTACATAGCAC >M13-LCMT-F E02.ab1TAAAGCCATTTACCGTACATAGCAC >M14-LCMT-F_F02.ab1TAAAGCCATTTACCGTACATAGCAC325 >M15-LCMT-F_G02.ab1TAAAGCCATTTACCGTACATAGCAC >M16-LCMT-F_H02.ab1TAAAGCCATTTACCGTACATAGCAC>M12-LCMT-F_D02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M13-LCMT-F_E02.ab1ATTACAGTCAAATCCCTTCTCGTCC >M14-LCMT-F F02.ab1ATTACAGTCAAATCCCTTCTCGTCC350>M15-LCMT-F G02.ab1ATTACAGTCAAATCCCTTCTCGTCC>M16-LCMT-F_H02.ab1ATTACAGTCAAATCCCTTCTCGTCC w >M12-LCMT-F_D02.ab1CCATGGATGACCCCCCTCAGATAGG>M13-LCMT-F_E02.ab1CCATGGATGACCCCCCTCAGATAGG >M14-LCMT-F_F02.ab1CCATGGATGACCCCCCTCAGATAGG375 >M15-LCMT-F_G02.ab1CCATGGATGACCCCCCTCAGATAGG>M16-LCMT-F_H02.ab1CCATGGATGACCCCCCTCAGATAGG>M12-LCMT-F_D02.ab1GGTCCCTTGACCAC>M13-LCMT-F_E02.ab1GGTCCCTTGACCAC >M14-LCMT-F_F02.ab1AGTCCCTTGACCAC >M15-LCMT-F_G02.ab1GGTCCCTTGACCAC>M16-LCMT-F H02.ab1GGTCCCTTGACCAC 400 solve the inequality 2(n + 3) - 4 < 6. then graph the solution Nonvascular plants differ from vascular plants by A. how they transport water and nutrients. B. how they move in their environment. C.how they respond to their environment. D. how they make their food. The value of the expression -20 - 16 is1)262)143)-144)-26 What is the amount of the gradient series portion of the cash flows (do not include the uniform series portion) A plane is flying 700 km/hr to the east into a head wind that is moving at 20 km/hr west. Calculatethe planes velocity. Protein folding is heavily driven by an increase in the entropy of water and the decrease in the entropy of nonpolar regions of the protein . This concept of nonpolar aggregation to avoid interactions with water is more commonly known as the If the range of a projectile is and 2563 m in the maximum height reached is 64 m. calculate the angle of projection Calculate the standard change in Gibbs free energy for the following reaction at 25C3H2(g)+Fe2O3(s) ---> 2Fe(s)+3H2O(g)delta G (rxn) = ____ kJ "the third eye" in the national theatre of deaf, what is the purpose of the play? How do we add 2 to 4 digit number? Mrs Rama uses three types of fruit juice for a party. The ratio of the amount of watermelon juice to the amount of apple juice is 4: 9. The Ratio of the amount of apple juice to the amount of orange juice is 27: 14. Find the ratio of the amount of watermelon juice to the amount of apple juice to the amount of orange juice in its simplest form If a population experiences no migration, is very large, has no mutations, has random mating, and there is no selection, which of the following would you predict?A .The makeup of the populations gene pool will remain virtually the same as long as these conditions holdb. The population will evolve, but much more slowly than normalc. Dominant alleles in the populations gene pool will slowly increase in frequency while recessive alleles will decreased. The composition of the populations gene pool will change slowly in a predictable mannere. The population probably has an equal frequency of A and a alleles