Describe the locations, functions, and hormones of the thyroid gland and parathyroid.

Answers

Answer 1
The thyroid gland and parathyroid glands are a group of endocrine glands located in the base of the neck. These glands play a vital role in maintaining the body's homeostasis by producing hormones that regulate the body's metabolism and free calcium levels.

Related Questions

Design and organise learning experiences according to your local circumstances when teaching Processing (including traditional processing of raw materials; metal processing; food processing)​

Answers

When teaching Processing, it is essential to design and organize learning experiences that align with local circumstances and provide practical applications.

Here is a suggested approach for teaching Processing, including traditional processing of raw materials, metal processing, and food processing, considering local circumstances:

1. Introduction and Contextualization:

Start by introducing the concept of processing and its importance in various industries. Provide examples of local raw materials, metals, and food products that undergo processing. Discuss the significance of processing in the local economy and its impact on society.

2. Field Trips and Industry Visits:

Arrange field trips to local processing facilities such as factories, mills, or food processing plants. These visits offer students firsthand exposure to different processing techniques and machinery. Encourage students to observe and interact with professionals in the field, asking questions and understanding the practical aspects of processing.

3. Hands-on Workshops:

Organize hands-on workshops where students can engage in practical activities related to processing. For example, set up a metalworking workshop where students can learn basic metal processing techniques like cutting, shaping, and welding. Provide guidance on safety measures and proper tool usage.

4. Local Case Studies:

Explore local case studies of successful processing businesses or initiatives. This could involve inviting guest speakers from local processing companies or inviting entrepreneurs who have started their own processing ventures. Students can learn about the challenges, opportunities, and sustainable practices in the local processing industry.

5. Project-Based Learning:

Assign project-based tasks that allow students to apply their knowledge of processing. For example, students could design and develop a prototype for a food processing machine or propose innovative methods to improve traditional processing techniques using local resources. Encourage creativity, critical thinking, and problem-solving skills throughout the project.

6. Community Engagement:

Encourage students to engage with the local community by organizing outreach programs related to processing. This could involve organizing workshops for local artisans or collaborating with local farmers to develop value-added food products. Such activities foster a sense of social responsibility and provide students with real-world experiences.

7. Assessment and Reflection:

Regularly assess student understanding through quizzes, assignments, and presentations. Encourage reflective practices where students can evaluate their own learning journey and identify areas for improvement. Incorporate feedback mechanisms to continuously enhance the learning experiences.

By designing learning experiences that incorporate field trips, hands-on workshops, local case studies, project-based learning, community engagement, and reflective practices, students will develop a holistic understanding of processing and its significance in their local context. This approach will equip them with practical skills, foster creativity, and promote an entrepreneurial mindset, preparing them for future opportunities in the processing industry.

For more questions on Workshops, click on:

https://brainly.com/question/27603871

#SPJ8

Please hurry. Which of the following examples includes only chemical changes that occur in the digestive process?
A: Absorption of nutrients by villi in the small intestines
B: Chewing and swallowing food
C:Recycling of water from dissolved food back into the body
D: Reaction of saliva, stomach acid, bile, and pancreatic juices with food

Answers

The example that includes only chemical changes that occur in the digestive process is the reaction of saliva, stomach acid, bile, and pancreatic juices with food. Option D.

What are chemical changes?

Chemical changes refer to changes to the chemical properties of substances. In biological reactions, these substances are referred to as reactants.

Chemical changes are different from physical changes. In physical changes, only the physical properties of substances are altered while their chemical properties remain intact.

When a substance changes chemically, its physical properties most often change along. However, this is not in all cases.

Thus, looking at the examples given, their classification into either physical or chemical changes is as follows:

Absorption of nutrients by villi in the small intestines: physical changeChewing and swallowing food: physical changeRecycling of water from dissolved food back into the body: physical changeThe reaction of saliva, stomach acid, bile, and pancreatic juices with food.

When saliva, stomach acid, bile, and pancreatic juices react with food, the chemical properties of food change because the enzymes convert different components of food from one form to another as part of the process of digestion.

More on chemical changes can be found here: https://brainly.com/question/23693316

#SPJ1

How is a scientific law different from a scientific theory?

Answers

Answer:

Scientific law is a description of an event. Scientific theory is the explanation for that event.

Explanation:

Or in better words, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation for a phenomenon is called a scientific theory

Which of the following choices is an example of an acquired trait?
a human is born with brown eyes
a dog’s ears are bandaged so that they stand upright and her tail is docked short
a horse is born with a light-colored mane
a cat is born with black and white fur

Answers

Answer:

both

Explanation:

u both acquire it from ur parents

part of ur family members can have brown eyes

dogs father may have a damaged hair

a horse u should know

ans a cat when ur mom is black and ur dad is white

hope this was helpful

Which statement about stress is TRUE?

People living in war zones do not have higher levels of chronic stress than those in non-war zones.
There is no correlation between stress levels and serious medical diseases, such as cancer and heart disease.
Living in a violent neighborhood will not influence your physical health if you remain tough.
Children with asthma who were exposed to violence experience a greater amount of stress-related asthma symptoms.

Answers

I want to say D

children with asthma who where

What’s everyone’s favorite tv show or movie?

Answers

I dont watch tv shows or movies

lol

Help please ASAP please fast

Help please ASAP please fast

Answers

Answer:A. To make a copy of the cell,s DNA

Help!!!!!!!!!!!!!!!!!!!!!
The diagram below shows a microscopic view of the lower epidermis of a maple leaf. The cell indicated by the letter B is a guard cell. Guard cells are found on each side of the stomata.

Which of the following statements correctly describes how guard cells affect the physiological processes in a leaf?


A. Guard cells shrink to let in pollen for plant reproduction and swell to keep in oxygen.

B.Guard cells shrink to let in carbon dioxide for photosynthesis and swell to limit transpiration.

C. Guard cells shorten to let in light for photosynthesis and elongate to keep water from entering the cell.

D. Guard cells become rounder to let in oxygen for cellular respiration and flatten out to block the release of carbon dioxide.

Help!!!!!!!!!!!!!!!!!!!!! The diagram below shows a microscopic view of the lower epidermis of a maple

Answers

Answer:

D is the answer of your quest.

Explanation:

D

The statement that correctly describes how guard cells affect the physiological processes in a leaf is as follows:

Guard cells shrink to let in carbon dioxide for photosynthesis and swell to limit transpiration.

Thus, the correct option is B.

What is Photosynthesis?

Photosynthesis may be defined as a type of process through which green plants and photosynthetic algae generally prepare their own food in the form of glucose with the help of carbon dioxide and water in the presence of sunlight.

Guard cells generally mediate the opening and closure of stomata. With the help of this activity, they regulate the rate of transpiration. Guard cells swell up and open the stomata for the exchange of gases when the plant has an excess of water and other useless gases. These types of cells are generally identified by their kidney-shaped appearance that surrounds the stomata.

Therefore, the correct option for this question is B.

To learn more about Guard cells, refer to the link:

https://brainly.com/question/83099

#SPJ2

features of intensive system in farm management

Answers

Answer:

I will anwer the question.

Explanation:

Pasture Intensification. ...

Rotational Grazing. ...

Concentrated Animal Feeding Operations (CAFOs) ...

Crop Irrigation. ...

Genetically Modified Organism (GMO) Seeds. ...

Use of Agrochemicals. ...

Livestock. ...

Aquaculture.

Tim has long eyelashes (dominant) and Karen has short eyelashes (recessive). Which statement is true?
O You know Tim's genotype and phenotype.
O You only know Tim & Karen's genotype.
O You know Karen's genotype and phenotype. O You know both Tim & Karen's genotype and phenotype.​

Answers

O You know Karen's genotype and phenotype.  

because short eyelashes is a recessive gene and that means it's present in two copies

Describe three similarities between seedless vascular plants and nonvascular plants?

Describe three similarities between seedless vascular plants and nonvascular plants?

Answers

Three similarities between seedless vascular plants and nonvascular plants:

1. They both belong to the Kingdom Plantae.

2. Both are capable of conducting photosynthesis because of the presence of chloroplasts.

3. Both of them are eukaryotes which means that they posses a true nucleus.

The pedigree below tracks the presence of attached earlobes through a family's generations. Having attached earlobes is an autosomal recessive trait.

If individual III-6 married a man who was homozygous for unattached earlobes, what is most likely to be true regarding their children?

Answer: CORRECT (SELECTED)
All of their children would have unattached earlobes.

Explanation
Individual III-6 has attached earlobes (ee). If she has children with a homozygous dominant man (EE), all of her children will be heterozygous and have unattached earlobes.

The pedigree below tracks the presence of attached earlobes through a family's generations. Having attached

Answers

A pedigree is a representation of a family history tracking a trait and  showing the inheritance pattern of the trait and its expression. The whole progeny expresses unattached earlobes.

What is an autosomal recessive trait?

The autosomal recessive trait is the characteristic that is coded by a gene located in an autosomal chromosome (this is, not a sex chromosome).

This trait is recessive because it is coded by the recessive allele, meaning that the dominant allele hides its expression.

The presence of only one dominant allele in the genotype is enough for the idividual to express free earlobes.

             Genotype                                  Phenotype    

EE, Homozygous dominant                  Free earlobes

Ee, Heterozygous                                  Free earlobes

ee, Homozygous recessive                   Attached earlobes

What is a pedigree?

The pedigree is the representation of a family history conserning a certain trait. In this case, attached earlobes.

The pedigree shows the expression -and inheritance pattern- of the trait through several generations.

To correctly interpret a pedigree, we need to know that

Family members

→ Individuals are represented with geometrical figures.

→ Males are squares

→ Females are circles

Trait/Phenotype

→ Healthy/normal/not affected  individuals are represented with empty figures

→ Affected/mutated individuals are represented with solid black figures

Generations

→ Each file is represented with a roman number, indicating the Generation.

In the exposed example, we will assume that

Individuals represented with solid figures -shaded individuals- express attached earlobes. Their genotype is ee.

Individuals with unattached earlobes are represented with empty figures and are EE and Ee.

According to this pedigree,

I- 1- man with attached earlobes (shaded)

I- 2- woman with unattached earlobes (empty)

II-1 - man with attached earlobes (shaded)

II-2 -woman with unattached earlobes (empty)

II-3 - man with attached earlobes (shaded)

II-4- do not have information

II-5 - woman with unattached earlobes (empty)

III-1 - man with attached earlobes (shaded)

III-2 - woman with attached earlobes (shaded)

III-3 - man with attached earlobes (shaded)

III-4 - no information

III-5 - No information

III-6 - woman with unattached earlobes (empty)

Since we so not have enough information, we will assume

individuals II-2, II-3, and II-4 are descendants of individuals I-1 and I-2. Individual II-1 marries II-2 and they have individuals III-1, III-2, and III-3.Individual II-4 marries individual II-5, and they have individuals III-4, III-5, and III-6.

Individual III-6 is a woman that expresses unattached earlobes. Since we do not know her genotype (homozygous or heterozygous), we will represent it as E- ⇒ The symbol - represents either the dominant or recessive allele.

This woman marries a man who was homozygous for unattached earlobes, EE.

Cross:

Parentals)  E-    x     EE

Gametes) E   -     E     E

Punnett square)  E       -

                    E     EE     E-

                    E     EE     E-

F1) 50% homozygous dominant EE

     50% is expected to be either homozygous dominant EE or heterozygous Ee

     100% is expected to have unattached earlobes.

Their whole progeny is expected to express unatached earlobes, because the father (EE) can only provide dominant alleles, and the simple presente of a dominant allele is enought to express the dominant trait.

IMPORTANT NOTE:

Up to this point we consider shaded shapes as individuals carring the trait attached earlobes. So, according to this reasoning, all shaded individuals must express the recessive trait and genotype ee.

However, according to the provided explanation, shaded individuals express the dominant trait.

If this is the case, individual III-6 is homozygous recessive ee expressing attached earlobes.

When she marries a homozygous dominant man expressing unattached earlobes EE, their children will only be heterozygous Ee and express unattached earlobes.

You will find both options in the attaced files. In any case, the whole progeny expresses unattached earlobes.

You can learn more about pedigrees at

brainly.com/question/19516649

#SPJ1

The pedigree below tracks the presence of attached earlobes through a family's generations. Having attached

Answer:

all of their children would have unattached earlobes

Explanation:

Why does a virus lethal to us not infect animals? I know that RNA viruses mutate at 10,000 to a million times faster than DNA viruses. wouldn't that give enough time for the virus to mutate a ability to infect other organisms?

Answers

The virus needs to speak the molecular language of cells. This is how he manages to dominate and enslave them so that they become factories for new viruses, producing the proteins that the infectious agent requires to assemble its descendants. If this conversation is not fine-tuned, even if the virus has the key and enters, it is doomed to failure.

Why does a virus lethal to us not infect animals?

For a virus to be able to enter a cell, it must have the right key. And this key, which are the proteins on the surface of viruses, has to enter the correct lock, the receptors that are on the cell membrane. Cells are actually houses with many different doors and locks. Some viruses have keys that open the lock of any cell and any kind of host, and others do not, so the infection caused by viruses is specific.

With this information, we can conclude that some viruses have keys that open the lock of any cell and any kind of host, and others do not, so the infection caused by viruses is specific.

Learn more about virus in brainly.com/question/1427968

#SPJ1

Calculate the population density of 900 sheep in a plot of land that is 3.00 km by 2.00km

Answers

The population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.

The population density of 900 sheep in a plot of land that is 3.00 km by 2.00 km can be calculated by dividing the total number of sheep by the area of the land.

First, we need to calculate the area of the land. The area can be found by multiplying the length and width of the plot of land:

Area = length × width = 3.00 km × 2.00 km = 6.00 km²

Next, we divide the total number of sheep by the area to calculate the population density:

Population Density = Total number of sheep / Area = 900 sheep / 6.00 km²

Performing the calculation, we find:

Population Density = 150 sheep/km²

Therefore, the population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.

Population density is a measure of the number of individuals (in this case, sheep) per unit area. By dividing the total number of sheep by the area of the land, we obtain the population density in terms of sheep per square kilometer. In this case, the population density is 150 sheep/km², indicating that there are, on average, 150 sheep within each square kilometer of the land.

For more such answers on Population

https://brainly.com/question/29885712

#SPJ8

1 pts
Which of the following are examples of discontinuous variation? (select all that apply)

Answers

Answer:

what answer choices are there?

Explanation:

person's blood group or the color of a species of bird is what i think

Answer:

Hindi KO alam putang ina

PLEASE HELP ASAP I WILL DO BRAINLYIST

PLEASE HELP ASAP I WILL DO BRAINLYIST

Answers

Answer:

There would be more prey in the world because the mountain lion would never exist.

Explanation:

The cholera toxin causes intestinal cells to pump out their chloride ions

Answers

Answer: This bacterium can survive passage through the acidic conditions of the stomach. Inside the small intestine, V. cholerae attaches to the intestinal wall and starts producing cholera toxin. The toxin enters intestinal cells, causing them to release water and ions, including sodium and chloride ions.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

What are some reasons for organisms having lots of offspring?

Answers

Answer:

Mammals

Explanation:

Because their fertility rate decreases slowly untill their death period in the duration they produce many offspring Take one example as:Dog,Cat,pig etc

Answer:

higher chance of survival within the wild

Select the correct answer from each drop-down menu.
L
The nervous system and the muscle system respond to stimuli to produce motion. The movements of
v muscles are mostly
voluntary. Involuntary movements occur in these muscles when the nerve impulse passes from a sensory neuron CO
motor neuron via
an interneuron in the
v
Reset
Next

Answers

The correct answer from the listed options is that the nervous system and the muscle system respond to stimuli to produce motion (option A).

What is nervous system?

Nervous system is the organ system that coordinates the activities of muscles, monitors organs, constructs and processes data received from the senses and initiates actions.

On the other hand, the muscle is a contractile form of tissue which animals use to effect movement.

The nervous system controls the muscle, hence, it controls movement of limbs in higher organisms.

Therefore, the correct answer from the listed options is that the nervous system and the muscle system respond to stimuli to produce motion.

Learn more about muscle and nervous system at: https://brainly.com/question/12003752

#SPJ1

Answer:

Explanation:skeletal

                     Spinal

From the video segment about crows in Japan:
What mechanism did the crows use to crack open the nuts for food?

Answers

Answer:

is this ur fist time doing this?

Explanation:

can i know a little more about this pls then i might be able to help!

A classification grouping that consists of a number of similar, closely related species?

Answers

According to the research, the correct option is genus. A classification grouping that consists of a number of similar, closely related species is called a genus.

What is a genus?

It is a taxonomic category that is part of systematic biology, which is located between the family and the species, that is, it includes many species that are related to each other.

In this sense, it is a taxon that allows living beings to be classified based on a hierarchy of inclusion, in this case grouping together closely related species, being a group of organisms that in turn can be divided into several species.

Therefore, we can conclude that according to the research, the correct option is genus. A classification grouping that consists of a number of similar, closely related species is called a genus.

Learn more about genus here: https://brainly.com/question/12980208

#SPJ1

Is grass poking through a sidewalk crack primary or secondary succession? Why?

Is grass poking through a sidewalk crack primary or secondary succession? Why?

Answers

Answer:

Primary and secondary succession differ because primary is where no soil or organisms exist, but secondary succession is where soil and organisms exist. ... Grass poking through a sidewalk crack would be considered secondary succession because before the sidewalk was built, an ecosystem was there.

.

Hope it helps

aging is associated with__ production of antibodies

Answers

Aging is associated with decreased production of antibodies.

a decrease/the reduction
Older people produce fewer antibodies, and the strength of their immune system weakens. Which is why older people are weaker compared to young men in their 20s.

how many hydrogen atoms are contained in a singleolecule of sucrose A, 6 B,12 C,22 D,24​

Answers

Answer:

C 22

Explanation:

29. Brain has one son, two grandchildren, and three great-grandchildren. This is example of
O exponential growth.
Odynamic growth.
O linear growth.
Obinary growth.

Answers

This is an example of exponential growth.

Exponential growth refers to a pattern of growth where the quantity or size of something increases at an accelerating rate over time.

In the given scenario, Brain has one son, two grandchildren, and three great-grandchildren.

Each generation is producing more offspring, resulting in a rapidly increasing number of descendants.

The progression from one generation to the next demonstrates exponential growth because each subsequent generation adds more individuals than the previous one.

As the generations continue, the number of descendants grows exponentially larger.

Exponential growth can be observed in various natural and human-made systems, such as population growth, compound interest, and the spread of infectious diseases.

In this case, the number of descendants in Brain's family tree follows an exponential pattern, as each new generation multiplies the number of offspring, leading to a significant growth rate.

Therefore, the example given aligns with the concept of exponential growth.

For more answers on exponential growth

https://brainly.com/question/13223520

#SPJ8

………………………dguhbjirviuhb

Answers

shvgushiirv dtknfussf

Efforts to reduce pollution are part of the sustainability movement.

Choose the item that is NOT a goal aimed at reducing pollution.


Modifying varieties of crops and planting dates

Controlling erosion so that soil doesn’t flow into waterways

Monitoring and control disease-related pollutants

Creating policies that limit the number of children families can have

Answers

The item that is NOT a goal aimed at reducing pollution is "Creating policies that limit the number of children families can have". The other three items are all aimed at reducing pollution. Modifying varieties of crops and planting dates can help reduce pollution by reducing the amount of pesticides and fertilizers used in agriculture¹. Controlling erosion so that soil doesn’t flow into waterways can help reduce water pollution¹. Monitoring and controlling disease-related pollutants can help reduce air pollution¹.

What are long chains of underwater mountain ranges called?

A. continental rise
B. mid-ocean ridges
C. volcanic islands
D. abyssal hills

Answers

B mid-ocean ridges ........
I believe the answer is B:mid-ocean ridges

We went over this in school

Hope this helps you
Good luck

what are the solution of marginalization of indigenous people​

Answers

Focus on the priorities. ...
Include indigenous people in discussions of land use. ...
Apply the law to ensure land rights are protected. ...
Build public awareness. ...
Recognise their role in conservation. ...
Bridge the gap between policy and practice
Other Questions
Arizona Company is considering an investment in new machinery. The annual incremental profits/(losses) relating to the investment are estimated to be: $'000 Year 1 (11) Year 2 3 Year 3 34 Year 4 47 Year 5 8 Investment at the start of the project would be $175,000. The investment sum, assuming nil disposal value after five years, would be written off using the straight-line method. The depreciation has been included in the profit estimates above, which should be assumed to arise at each year end. Required: B. Calculate the net present value (NPV) of the investment at a discount rate of 10% per annum (the company's required rate of return) (7 marks) Discount factors at 10% are: Year 1 0.909 Year 2 0.826 Year 3 0.751 Year 4 0.683 Year 5 0.621 B. State, on the basis of your calculations above, whether the investment is worthwhile. Justify your statement. can someone help me please Fill in the blank with the correct definite article (el, la, los, las). cursos I put 100 points please help.Question 1 (2 points) Choose the correct answer.El avin sale cuando _____.Question 1 options:est despegandoest aterrizandohay una demoralos pasajeros hacen las maletasQuestion 2 (2 points) Indicate whether each statement is true or false.Los pasajeros deben hacer cola para abordar el avin.Question 2 options:verdadfalsoQuestion 3 (2 points) Match the opposites.Question 3 options:embarcaraterrizarla salidael despegue1. el aterrizaje2. despegar3. desembarcar4. la llegadaQuestion 4 (2 points) Indicate whether each statement is true or false.Antes de abordar un vuelo todos los pasajeros tienen que pasar por el control de seguridad.Question 4 options:verdadfalsoQuestion 5 (2 points) Choose the correct answer.En qu ____ estamos viajando?Question 5 options:agentelnea areaaeropuertodistribuidor automticoQuestion 6 (2 points) Answer true if the statement makes sense; answer false if it does not.El avin espera en la pista antes de despegar.Question 6 options: True FalseQuestion 7 (2 points) Answer true if the statement makes sense; answer false if it does not.Si el avin est saliendo a tiempo no hay un retraso.Question 7 options: True FalseQuestion 8 (2 points) Indicate if the following statements are true or false.El pasaporte es una forma de identidad oficial.Question 8 options:verdadfalsoQuestion 9 (2 points) Choose the correct answer.Su vuelo sali con una demora; por eso, ella va a llegar _____.Question 9 options:a bordoa tiempoa vecestardeQuestion 10 (2 points) Indicate whether each statement is true or false.Es necesario tener un pasaporte para viajar de un estado a otro en Estados Unidos.Question 10 options:verdadfalsoQuestion 11 (2 points) Part C VocabularyChoose what you need to complete the task.Tengo que lavarme el pelo.Question 11 options:el champuna toallael jabnun cepillo de dientesun peineQuestion 12 (2 points) Part I LecturasEl campingThink of the reading and choose the word or phrase that best completes the sentence.El camping es una manera ___________ de viajar.Question 12 options:caraeconmicafcilQuestion 13 (2 points) Part E VocabularyChoose the word or phrase that best completes the sentence.________ de ayudarme. No lo puedo hacer solo.Question 13 options:Ya voyAcFavorQuestion 14 (2 points) Part F GrammarYo _____(21)_____ levant _____(22)_____.Nosotros _____(23)_____ acost _____(24)_____ temprano.T _____(25)_____ llam _____(26)_____ Jorge y tu mejor amiga _____(27)_____ llam _____(28)_____ Leonora.Por qu no _____(29)_____ quit _____(30)_____ ustedes la chaqueta?Complete blank 21 with the correct pronoun.Question 14 options:temesenosQuestion 15 (2 points) Part D VocabularyChoose the correct word.una parte del brazoQuestion 15 options:el codola rodillala cabeza which new deal program is being described below? this organization helped reduce unemployment by giving jobs to 17- to 25-year-old men. these men planted trees, maintained parks, and completed various building projects. Which situations can be represented by an exponential function?Select each correct answer. The value of a vehicle decreases by 11% each year. In a structure made of bricks, each row has 10 more bricks than the previous row. A dentist's office accepts 15 new patients each month. Every year, the number of online video subscriptions increases by 3 times what is was the previous year. The mid segment of a trapezoid is 15inches long. One of the bases is 25 inches long. Find the length of the other base? Breyers and Reese's have worked together to create Breyers Ice Cream with Reese's Peanut Butter Cups. This is an example of ________. Group of answer choices suppose that 30% of the applicants for a certain industrial job possess advanced training in computer programming. applicants are interviewed sequentially and are selected at random from the pool. find the probability that the first applicant with advanced training in programming is found on the fifth interview. Which of the following describes the changes in forces of attraction that occur as H,O changes phase from liquid to vapor? H-0 bonds break as H - H and 0-0 bonds form_ Hydrogen bonds between H,O molecules are broken Covalent bonds between H,O molecules are broken Ionic bonds between H+ ions and OH- ions are broken Covalent bonds between H+ ions and H,O molecules become more effective a competitive market is in equilibrium. then there is a decrease in demand and a decrease in supply. the equilibrium price , and the equilibrium quantity . Explain how a person can become dependent on an addictive drug or behaviour. I need help asap please WILL GIVE BRAINLIEST!! PLS HELPRead the following poem, You Begin, by Margaret Atwood.xYou Beginby Margaret AtwoodYou begin this way:this is your hand,this is your eye,that is a fish, blue and flaton the paper, almostthe shape of an eye.This is your mouth, this is an Oor a moon, whicheveryou like. This is yellow.xOutside the windowis the rain, greenbecause it is summer, and beyond thatthe trees and then the world,which is round and has onlythe colors of these nine crayons.xThis is the world, which is fullerand more difficult to learn than I have said.You are right to smudge it that waywith the red and thenthe orange: the world burns.xOnce you have learned these wordsyou will learn that there are morewords than you can ever learn.The word hand floats above your handlike a small cloud over a lake.The word hand anchorsyour hand to this table,your hand is a warm stoneI hold between two words.xThis is your hand, these are my hands, this is the world,which is round but not flat and has more colorsthan we can see.xIt begins, it has an end,this is what you willcome back to, this is your hand.xThe endxConcentrate on the following stanza:Once you have learned these wordsyou will learn that there are morewords than you can ever learn.The word hand floats above your handlike a small cloud over a lake.The word hand anchorsyour hand to this table,your hand is a warm stoneI hold between two words.Answer the following questions:1. What does the cloud in the simile represent?2. What does the warm stone signify? Is it only the child's hand?3. how is this description different from saying simply that the hand is warm?4. How is this description different from saying the hand is like a warm stone?5. Is this an effective metaphor? Why or why not? 2. Why do people MOST LIKELY ignore the warning signs of cancer?Cancer typically develops gradually, and the signs and symptoms aren't initially severe.People dislike going to the doctor, so they choose to ignore the warning signs.OMost people who have cancer don't experience any warning signs.By the time people notice the warning signs of cancer, it's already too late. Question:In the following system of equations, what would be the first step to solving the system of equations? {5x+9y=1610x+4y=11-----Options:Add the equations togetherSubtract the equations from each otherMultiply the bottom equation by 2Multiply the top equation by 2 A cookie is stored on your device's memory or disk in what file format? 1.)video file2.) audio file 3.)image file 4.) text file which of the following option requires little or no up-front investment? group of answer choices direct sourcing full package cmt joint venture Use the map and the provided ruler to find the actual distance between cities. The actual distance between Kalamazoo and Ann Arbor is ___ miles. An exponential relationship has a growth factor of 3 and y-intercept of 4. Evaluate the function that represents this relationship where x = 10.