Evaluate (gºf)(-3) given f(x) = 3x2 + 2x + 1 and g(x) = 2 – 5.

Answers

Answer 1

The value of the (gºf)(x) is 17.

What is the function?

A function from a set X to a set Y allocates exactly one element of Y to each element of X. The set X is known as the function's domain, while the set Y is known as the function's codomain. Originally, functions were the idealization of how a variable quantity depends on another quantity.

Here, we have

Given: f(x) = 3x² + 2x + 1

g(x) = x - 5

we have to find the value of (gºf)(-3).

First, we will find the value of  (gºf)(x)

(gºf)(x) = g(f(x))

= g(3x² + 2x + 1)

= 3x² + 2x + 1 - 5

(gºf)(x) = 3x² + 2x - 4

Now, we put the value of x = -3 and we get

(gºf)(-3) = 3)(-3)² + 2(-3) - 4

(gºf)(x) = 27 - 6 - 4

(gºf)(x) = 17

Hence, the value of the (gºf)(x) is 17,

To learn more about the function from the given link

https://brainly.com/question/10439235

#SPJ4


Related Questions

given the following distribution: outcome value of random variable probability a 1 .4 b 2 .3 c 3 .2 d 4 .1 the expected value is 3. group of answer choices true false

Answers

The expected value of the given probability distribution is not 3 so, the given statement is false.

The expected value, also known as the mean or average, is a measure of central tendency that represents the weighted average of the possible outcomes of a random variable. To calculate the expected value, we multiply each outcome by its corresponding probability and sum them up.

In the given distribution, we have four outcomes (a, b, c, d) with their respective values and probabilities.

To find the expected value, we multiply each outcome by its probability and sum them up:

(1 * 0.4) + (2 * 0.3) + (3 * 0.2) + (4 * 0.1)

= 0.4 + 0.6 + 0.6 + 0.4

= 2

Therefore, the expected value of the given distribution is 2. This means that, on average, the random variable will yield a value of 2.

Since the expected value calculated from the given distribution is 2 and not 3, the statement "The expected value is 3" is false.

Learn more about probability distribution here:

https://brainly.com/question/23286309

#SPJ11

Which statement must be true to prove

Which statement must be true to prove

Answers

The answer would be C hope this helps

2. Use Laplace transform to solve the ODE f"(t) + 6ƒ' (t) + 13ƒ(t) = 48(t – 5) with initial conditions ƒ(0) = 0, ƒ'(0) = 0, where 8(t) is the Dirac delta function. [10]

Answers

The final solution in terms of the inverse Laplace transforms:

\(ƒ(t) = L^{-1}[F(s)]\)

We have,

To solve the given ordinary differential equation (ODE) using Laplace transform, we'll follow these steps:

Step 1: Take the Laplace transform of both sides of the equation.

Step 2: Solve for the Laplace transform of the function ƒ(t).

Step 3: Take the inverse Laplace transform to obtain the solution in the time domain.

Let's go through these steps:

Step 1: Taking the Laplace transform of the ODE, we have:

L[f"(t)] + 6L[f'(t)] + 13L[f(t)] = 48L[t - 5]

Step 2: Applying the Laplace transform properties and using the initial conditions, we get:

\(s^2F(s) - sf(0) - f'(0) + 6(sF(s) - f(0)) + 13F(s) = 48(e^{-5s}/s)\)

Simplifying, we have:

\(s^2F(s) + 6sF(s) + 13F(s) - s(0) - 0 + 6sF(s) - 6(0) + 13F(s) = 48(e^{-5s}/s)\)

Combining like terms, we obtain:

\((s^2 + 6s + 13)F(s) = 48(e^{-5s}/s)\)

Step 3: Solving for F(s), we have:

\(F(s) = 48(e^{-5s}/s) / (s^2 + 6s + 13)\)

To find the inverse Laplace transform of F(s), we can use partial fraction decomposition, but the expression involves complex roots.

Therefore,

The final solution in terms of the inverse Laplace transforms:

\(ƒ(t) = L^{-1}[F(s)]\)

Learn more about differential equations here:

https://brainly.com/question/32538700

#SPJ4

Can someone pls pls help me with the middle one im struggling :( TYSM IF U DO!

Can someone pls pls help me with the middle one im struggling :( TYSM IF U DO!

Answers

Answer:

900 people

Step-by-step explanation:

540 / 60 = 9

10% = 9

9 x 100 = 900 people

Hope that helps!

Answer: 900

Explanation:

GEOMETRY: PLEASE HELP!!!
A rectangle is removed from a right triangle to create the
shaded region shown below. Find the area of the shaded
region. Be sure to include the correct unit in your answer.
9cm
5cm
2cm
9cm

GEOMETRY: PLEASE HELP!!!A rectangle is removed from a right triangle to create theshaded region shown

Answers

Answer:

30.5 or 61/2 cm²

Step-by-step explanation:

So the area of the figure is shown by this equation.

Area = Area of triangle - Area of rectangle cut out

        = (0.5)(9)(9) - (2)(5)

        = 40.5 - 10

        = 30.5 or 61/2 cm²

The answer is 30.5 cm ^2
(30.5 centimeters squared)
GEOMETRY: PLEASE HELP!!!A rectangle is removed from a right triangle to create theshaded region shown

Hii, so this was one of the questions on a previous CSAT exam (korean sat). I was curious and decided to look at a few questions. This question I found was particularly interesting and I am close to figuring it out but i keep getting stuck. Would anyone like to explain how this works and how to solve it?

Hii, so this was one of the questions on a previous CSAT exam (korean sat). I was curious and decided

Answers

Answer:

Step-by-step explanation:

Well you can calculate the area of the base side by the integration of cos - sin x over the limits x = 0 and x = π/6.

Then I think one side of the square  would be cos π/6 - sin  π/6.

So I think the required volume  can be worked out as area of base * length of a side of the square.

I think that,s the way to do it, if i have interpreted the question correctly.

In the past year Hans watched 16 movies that he thought were very good. He watched 25 movies over the whole year. Of the movies he watched, what percentage did he rate as very good?

Answers

Answer:

64% of the movies he watched were rated as very good

Step-by-step explanation:

\(\frac{16}{25} = \frac{x}{100}\)

16*100 = 1600

1600/25 = 64

\( \huge \underline{ \boxed{ \color{cyan}\tt \dag \: Answer}}\)

Total movies watched by Hans = 25Number of movies rated as very good by Hans = 16Percentage of movies rated as very good = ?

\(\tt : \implies percentage = \dfrac{16}{25} \times 100\% \\ \\ \tt : \implies percentage = 16 \times 4 \% \\ \tt : \implies percentage = 64\% \\ \)

\( \color{fuchsia} \tt Hence, \: Answer \: is \: 64 \%.\)

The product of w and 2 is greater than or equal to 19.

Answers

Equation Form:

w x 2 \(\geq\) 19

Divide both sides by 2:

w \(\geq\) 9.5

So, w must be equal to or greater than 9.5 for this equation to work.

How many solutions does the system have? zero one two three four infinitely many

Answers

There is just one solution to the system of equations 2y = 5x + 4, y = 3x + 2.

What is meant by mathematical equations?An equation is a mathematical statement that proves two mathematical expressions are equal in algebra, and this is how it is most commonly used. In the equation 3x + 5 = 14, for instance, the two expressions 3x + 5 and 14 are separated by the symbol "equal." Standard form, slope-intercept form, and point-slope form are the three main types of linear equations.Equations can be classified as either conditional equations or identities. Any value of the variables results in an identity being true. Only certain values of the variables in a conditional equation result in truth. When two expressions are joined together by the equals sign ("="), the result is an equation.

Given

The system:

2 y = 5 x + 4

y = 3 x + 2

------------------

We will substitute y in the 1st equation:

2 ( 3 x + 2 ) = 5 x + 4

6 x + 4 = 5 x + 4

6 x - 5 x = 4 - 4

x = 0

Answer: C ) one solution.

The complete question is:

How many solutions does the following system of equations have?

2y=5x+4

y=3x+2

a) infinitely many

b) zero

c) one

d) two

To learn more about mathematical equations, refer to:

https://brainly.com/question/25976025

#SPJ4

Use the information from the article to answer the question.

Dwarf Planet

Which statements apply to the orbits of dwarf planets? Check all that apply.

Dwarf planets orbit the Sun.
Pluto could collide with Jupiter.
Dwarf planets are round.
Pluto is a dwarf planet.
Eris could collide with Uranus (SCIENCE)

Answers

Answer:

Drawf planets orbit the Sun.

Dwarf planets are round.

Pluto is a dwarf planet.

Answer:a,c,d

Step-by-step explanation:

edge 2023

Find the surface area for a sphere with a radius of 10 feet. Round to the nearest whole number.
a. 1,256 ft2
b. 4,189 ft2
c. 1,089 ft2
d. 1,568 ft2

Answers

The required surface area of the sphere with radius 10 feet is given by option a. 1,256 ft².

Let us consider 'r' be the radius of the sphere.

Radius of the sphere 'r' = 10 feet

Surface area of the sphere = 4 π r²

Substitute the value of radius in the formula we get,

⇒ Surface area of the sphere = 4 π × ( 10 )²

Substitute value of π is equal to 3.14 we get

⇒ Surface area of the sphere = 4 × 3.14 × ( 10 )²

⇒ Surface area of the sphere =  12.56 × 100

⇒ Surface area of the sphere = 1,256 square feet.

Therefore, the surface area of the sphere is equal to option a. 1,256 ft².

learn more about sphere here

brainly.com/question/12390313

#SPJ4

what's the difference between the arithmetic and geometric average return (conceptually, not mathematically), and when is it best to use each?

Answers

Conceptually, the arithmetic and geometric average returns are different measures used to describe the performance of an investment or an asset over a specific period.

The arithmetic average return, also known as the mean return, is calculated by adding up all the individual returns and dividing by the number of periods. It represents the average return for each period independently.

On the other hand, the geometric average return, also called the compound annual growth rate (CAGR), considers the compounding effect of returns over time. It is calculated by taking the nth root of the total cumulative return, where n is the number of periods.

When to use each measure depends on the context and purpose of the analysis:

1. Arithmetic Average Return: This measure is typically used when you want to evaluate the average return for each individual period in isolation. It is useful for analyzing short-term returns, such as monthly or quarterly returns. The arithmetic average return provides a simple and straightforward way to assess the periodic performance of an investment.

2. Geometric Average Return: This measure is more suitable when you want to understand the compounded growth of an investment over an extended period. It is commonly used for long-term investment horizons, such as annual returns over multiple years.

The geometric average return provides a more accurate representation of the overall growth rate, accounting for the compounding effect and reinvestment of returns.

In summary, the arithmetic average return is suitable for analyzing short-term performance, while the geometric average return is preferred  evaluating long-term growth and the compounding effect of returns.

learn more about Average Return here:

https://brainly.com/question/29662426

#SPJ11

Which is the value of the expression (10⁴)(5²)
(10³)(5³)
A. 1
B. 2
C. 8
D. 10​

Which is the value of the expression (10)(5)(10)(5)A. 1B. 2C. 8D. 10

Answers

Answer:

C. 8

Step-by-step explanation:

This then simplifies to (10^1 times 5 ^ -1)cubed. 5^-1 is 1/5, and 10^1 is 10. 10 times 1/5 is 2, and 2^3 is equal to 8.

Suppose triangle ABC will be dilated using the rule D Subscript Q, two-thirds.

Point Q is the center of dilation. Triangle A B C is 6 units away from point Q. The length of A B is 3, the length of B C is 7, and the length of A C is 8.

What will be the distance from the center of dilation, Q, to the image of vertex A?

2 units
3 units
4 units
6 units

Answers

The distance from the center of dilation, Q, to the image of vertex A will be 4 units.

According to the given rule of dilation, D subscript Q, two-thirds, the triangle ABC will be dilated with a scale factor of two-thirds centered at point Q.

Since point Q is the center of dilation and the distance from triangle ABC to point Q is 6 units, the image of vertex A will be 2/3 times the distance from A to Q. Therefore, the distance from A' (image of A) to Q will be (2/3) x 6 = 4 units.

By applying the scale factor to the distances, we can determine that the length of A'B' is (2/3) x  3 = 2 units, the length of B'C' is (2/3) x 7 = 14/3 units, and the length of A'C' is (2/3) x 8 = 16/3 units.

Thus, the distance from the center of dilation, Q, to the image of vertex A is 4 units.

For more such answers on the Center of dilation
https://brainly.com/question/13173812

#SPJ8

Select all that apply.
To which sets does
belong?
5/8
real numbers
rational numbers
Irrational numbers
Integers
whole numbers
natural numbers

Answers

Answer:

real, rational

Step-by-step explanation:

The set to which the fraction 5/8 belongs to are real numbers and rational numbers.

What are real numbers and rational numbers?

A real number is a number that is both a rational number and an irrational number. A rational number is a number that can be expressed as a fraction of two integers

Examples of rational numbers are 1, 0, - 1, 5/8.

To learn more about rational numbers, please check: https://brainly.com/question/20435423

#SPJ2

Math question answer please
+5(9/3)²

Answers

Answer:

45

Step-by-step explanation:

.THIS IS DIFFERENTIALS EQUATION SUBJECT.
THE TOPIC WAS ALL ABOUT APPLICATIONS ON 1ST ORDER OF DIFFERENTIALS EQUATIONS In an episode of How to Get Away with Murder, the intern lawyers were investigating a murder case. During investigation, the forensics informed them that the dead body was found within a closed room of a house where the temperature was 70 F. At the time of discovery the core temperature of the body was determined to be 85 F. One hour later a second measurement showed that the core temperature of the body was 80 F. Assume that the time of death corresponds to * = 0 and the core temperature at that time was 98.6 F. Determine how many hours elapsed before the body was found.Provide what is needed. Show your full solutions, no shorthand. Do notapproximate the value of k, do
approximation after you find your final answer

Answers

Approximately 0.456 hours (or about 27.36 minutes) elapsed before the body was found.

To solve this problem, we can use Newton's Law of Cooling, which states that the rate of change of temperature of an object is proportional to the difference between its temperature and the surrounding temperature.

Let's denote T(t) as the core temperature of the body at time t, and T_s as the surrounding temperature (which is 70 F in this case).

According to the problem, at time t = 0, the core temperature of the body is T(0) = 98.6 F. One hour later, at t = 1, the core temperature is T(1) = 80 F.

Using Newton's Law of Cooling, we can set up the differential equation:

dT/dt = k(T - T_s)

where k is the proportionality constant.

Substituting the given values at t = 0 and t = 1, we can find the specific value of k.

At t = 0: dT/dt = k(98.6 - 70)

At t = 1: dT/dt = k(80 - 70)

Integrating both sides of the equation, we get:

∫ dT/(T - T_s) = ∫ k dt

Applying the natural logarithm, we have:

ln|T - T_s| = kt + C

Simplifying the equation, we get:

T - T_s = Ce^(kt)

Substituting the values at t = 0, we have:

98.6 - 70 = Ce^(k * 0)

Solving for C, we get:

C = 28.6

Now we can rewrite the equation as:

T - 70 = 28.6e^(kt)

At t = 1, we have:

80 - 70 = 28.6e^(k * 1)

Simplifying the equation, we get:

10 = 28.6e^k

Dividing both sides by 28.6, we have:

e^k = 10/28.6

Taking the natural logarithm of both sides, we get:

k = ln(10/28.6)

Now, we can use this value of k to determine how many hours elapsed before the body was found.

We want to find the value of t when T(t) = 85. Substituting this value into our equation, we have:

85 - 70 = 28.6e^(ln(10/28.6) * t)

15 = 28.6(10/28.6)^t

Dividing both sides by 28.6, we get:

15/28.6 = (10/28.6)^t

Taking the natural logarithm of both sides, we have:

ln(15/28.6) = t * ln(10/28.6)

Dividing both sides by ln(10/28.6), we can solve for t:

t = ln(15/28.6) / ln(10/28.6)

Calculating this expression, we find:

t ≈ 0.456 hours

Therefore, approximately 0.456 hours (or about 27.36 minutes) elapsed before the body was found.

Learn more about approximately from

https://brainly.com/question/27894163

#SPJ11

What transformation was not done to the linear parent function, f(x) = x, to get the function g(x) = - 5(x - 3) - 8 ? A. Reflection over the x-axis B. Shift down 8 units C. Horizontal stretch by a factor of 5 D. Shift right 3 units

Answers

Answer:

A. Reflection over the x-axis.

Step-by-step explanation:

Now, we present how to transform \(f(x) = x\) into \(g(x) = -5\cdot (x-3)-8\) below:

1) \(f(x) = x\) Given.

2) \(f(x-3) = x - 3\) Horizontal shift to the right.

3) \(-5\cdot [f(x-3)] = -5\cdot (x-3)\) Vertical scale factor.

4) \(-5\cdot f(x-3)-8 = -5\cdot (x-3)-8\) Vertical shift downwards.

5) \(g(x) = -5\cdot (x-3)-8\) Definition/Result

In consequence, the only transformation which was not done to the linear parent function was a reflection over the x-axis. The correct answer is A.

Find the slope- intercept from for the line Perpendicular to y-1/5x+5 passing through the point (3,-4)

Answers

It is just -4/4 hope this helps

Makalo’s budget is shown. Which circle graph best represents his budget? pls help i will give brainelist to right answer

Makalos budget is shown. Which circle graph best represents his budget? pls help i will give brainelist

Answers

Answer:4th one

Step-by-step explanation:

Answer: A

Step-by-step explanation:

Makalos budget is shown. Which circle graph best represents his budget? pls help i will give brainelist

manuel found a wrecked trans-am that he could fix. he bought the car for 65% of the original price of $7200. what did he pay for the car?

Answers

The amount of the car which is to be paid is $4680.

Cost:

The value of money that has been used up to produce something or deliver a service, and hence is not available for use anymore.

Here we have to find the original price of the car.

It is given that 65% of the original price of $7200 is.

Let x be the price of the car he has to pay.

So we have:

x = 7200× 65%

x =( 7200 × 65)/100

x = 4680

Therefore the amount to be paid is $4680.

To know more about the cost refer to the link given below:

https://brainly.com/question/2004396

#SPJ4

pls help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

pls help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer: they are adding 30 each time

Step-by-step explanation:

in 320 to 350, it adds 30 because 20 plus 30 equals 50 then you can add 300 which is 350 then 350 plus 30 is 380 which is also the next number which means you are adding 30 each time and for the first box you subtract 30 from 350 which is 320 and for the last box you add 30 which is 380 + 30 which is 410 so that is your answer.

A certain car's windshield wiper has a total length of 22 inches. As the wiper pivots it clears a sector with a central angle of 120 degrees. If only 18 inches of the wiper cleans the windshield, what is the area (in exact form) of the windshield that is wiped during each swing? 468π inches squared 156π inches squared 160π inches squared 108π inches squared

Answers

Answer: 108π inches squared

Step-by-step explanation:

Formula : Area of sector = \(\dfrac{\theta}{360^{\circ}}\times\pi r^2\)

where , r= radius and \(\theta =\)

Given : A certain car's windshield wiper has a total length of 22 inches. As the wiper pivots it clears a sector with a central angle of 120 degrees.

If only 18 inches of the wiper cleans the windshield, then we take radius of the range of wiper cleaining = 18 inches

The area of the windshield that is wiped during each swing = Area of the sector made by wiper of  with a central angle of 120 degrees.

\(=\dfrac{120}{360}\times\pi (18)^2\\\\=\dfrac{18^2}{3}\pi=\dfrac{18\times6}{1}\pi=108\p\text{ inches}^2\)

Hence, the area (in exact form) of the windshield that is wiped during each swing is 108π inches squared.

The manager of the Many Facets jewelry store models total sales by the function 1500: S(t) = 2+0.31 where is the time (years) since the year 2006 and S is measured in thousands of dollars. (a) At what rate (in dollars per year) were sales changing in the year 2010? (b) What happens to sales in the long run?

Answers

(a) The rate of sales change in 2010 was approximately $1,621.47 per year.

(b) in the long run, sales will continue to increase at an accelerating rate.



(a) The sales function for Many Facets jewelry store is given by S(t) = 1500(2+0.31)^t, where t is the time in years since 2006 and S is measured in thousands of dollars.

To find the rate of sales change in the year 2010, we need to determine the derivative of the sales function, which represents the rate of change in sales with respect to time.

The derivative of S(t) with respect to t is:
S'(t) = 1500 * ln(2+0.31) * (2+0.31)^t

Now, we need to find the rate of sales change in 2010. Since 2010 is 4 years after 2006, we will substitute t=4 into the derivative:
S'(4) = 1500 * ln(2+0.31) * (2+0.31)^4 ≈ 1621.47
So, the rate of sales change in 2010 was approximately $1,621.47 per year.

(b) To determine what happens to sales in the long run, we can analyze the behavior of the sales function S(t) as t approaches infinity:
lim (t -> ∞) S(t) = lim (t -> ∞) 1500(2+0.31)^t

Since the base of the exponent (2+0.31=2.31) is greater than 1, the sales function grows exponentially as time goes on. Therefore, in the long run, sales will continue to increase at an accelerating rate.

Know more about the exponential growth

https://brainly.com/question/13223520

#SPJ11

a sheet of paper measures 35cm by 25cm. A strip of 5cm width is cut from it all around. find the area of the remaining sheet and also the area of the cut-out strip

answer for brainlist

Answers

Total area of the paper is 875cm
If it’s cut 5cm width all around then that’s 1/5 of the paper
875/5= 175
175 is the total area of the cut out strip
700 is the new area of the cut paper

Nicole is back at it again and wants to see, this time, if listening to classical music while taking a test affects test scores. She is going to design an experiment to answer the question: Does listening to classical music while taking a test improve test scores? She will conduct this experiment with the 20 students in her class.
(a) What are the experimental units?
explanatory variable?
treatments?
response variable?

(b) What other potential variable could confound the results in this situation? How could they affect the results? How could we avoid their effects?

(c) Describe and design a completely randomized design for Nicole's experiment

Answers

Answer:

c,Describe and design a completely randomized design for Nicole's experiment

In the written exam in Math, there are 7
short answer questions. Peter will answer three of them.
How many combinations of short answer
questions are there?

Answers

Given a Math exam with 7 short answer questions and Peter intending to answer three of them, there are a total of 35 different combinations of short answer questions he can choose.

To determine the number of combinations, we can use the concept of combinations in combinatorics. The formula for combinations is given by:

C(n, r) = n! / (r! * (n - r)!)

Where:

C(n, r) represents the number of combinations of choosing r items from a set of n items.

n! denotes the factorial of n, which is the product of all positive integers up to n.

In this case, Peter wants to answer three out of the seven questions, so we can calculate it as:

C(7, 3) = 7! / (3! * (7 - 3)!) = 7! / (3! * 4!)

Simplifying further:

7! = 7 * 6 * 5 * 4 * 3 * 2 * 1

3! = 3 * 2 * 1

4! = 4 * 3 * 2 * 1

C(7, 3) = (7 * 6 * 5 * 4 * 3 * 2 * 1) / [(3 * 2 * 1) * (4 * 3 * 2 * 1)]

After canceling out common terms, we get:

C(7, 3) = 7 * 6 * 5 / (3 * 2 * 1) = 35

Therefore, there are 35 different combinations of short answer questions Peter can choose to answer.

Learn more about combinations in combinatorics here: brainly.com/question/13261685

#SPJ11

How to convert us dollar to thai baht?

Answers

Convert USD to THB, multiply amount of USD by the current exchange rate between USD and THB, which can be found on financial news or currency exchange websites, to get the equivalent amount in THB.

To convert US dollars (USD) to Thai baht (THB), you need to use the current exchange rate between the two currencies. Here are the steps to convert USD to THB:

Find the current exchange rate between USD and THB. This information can be found on financial news websites, currency exchange websites, or by contacting a bank or currency exchange service.

Multiply the amount of US dollars you want to convert by the current exchange rate to get the equivalent amount in Thai baht. For example, if the current exchange rate is 1 USD = 31.50 THB and you want to convert 100 USD to THB, the calculation would be:

100 USD x 31.50 THB/USD = 3,150 THB

Therefore, 100 USD is equal to 3,150 THB.

Note: The exchange rate between USD and THB can fluctuate over time, so make sure to use the current exchange rate for the most accurate conversion.

Learn more about  exchange rate here:

https://brainly.com/question/29562028

#SPJ4

Are any of these numbers an Integer?
15
20/5
44
13/19
-35.47
;w; help

Answers

Answer: 15, and 44 are integers.

Step-by-step explanation: For 15 to be an integer, 15 has to be a whole number. Furthermore, for 15 to be an integer, you should be able to write 15 without a fractional or decimal component. 15 is a whole number that can be written without a fractional component, thus 15 is an integer, as well as 44.

15 and 44

An integer is a whole number that is not a fraction since all the other numbers are not a whole your answer is 15 and 44.

PLEASE HELP!!!!! 20 POINTS!!! The Shultz family went apple picking. Jeshua picked 16 red apples, ½ as many yellow apples as red apples and 28 green apples. How many apples dir he pick in all?

Answers

The Shultz family piked 52 Apples

Answer:

He picked a total of 52

Step-by-step explanation:

You would add 16 (red apples), then divide 1/2 from the 16 red apples, +28 green apples which would equal 52.

Other Questions
cognitive dissonance happens when you are seeing inconsistent cognitions. however, this does not apply to inconsistent cognition and action. In a major study of leadership effectiveness, the Forum Corporation reports on the characteristics of successful leaders at middle to senior levels of responsibility. Identify a key finding of the study.A) Positions and titles are directly related to leadership performance.B) Organizational leadership involves individualism more than interdependence.C) An organization's environment plays an insignificant role in developing plans to meet organizational challenges.D) Leaders inspire others to take on the tasks of leadership. need help asap if someone can help i will be so happy what bipedal feature is exhibited by this distal femur of au. afarensis? Which of the following correctly pairs a greenhouse gas with its main human source?Methane and vehicular emissionsChlorofluorocarbons and combustion of coalNitrous oxide and agricultural practicesCarbon dioxide and solid waste from homes Dividend reinvestment plans (DRIPs) allow shareholders to reinvest their dividends in the company itself by purchasing additional shares rather than being paid out in cash. Understanding how dividend reinvestment plans work dividend reinvestment program invests the dividends in newly issued stock. This type of plan raises new capital for the firm. levels of participation in a dividend reinvestment program suggest that shareholders would be better served if the firm reduced its cash dividends. Why do firms use dividend reinvestment plans? Companies decide to start, continue, or terminate their dividend reinvestment plans for their shareholders based on the firms' need for equity capital. A firm might consider to using DRIPs if it needs additional equity capital. What is the most common reason for evidence to be excluded from trial What part of the tongue has chemical receptors?A. papillaeB. rootC. tipD. bodythank you very much!! :-) How does Steinbeck organize the information hereveals about the first family in the text? How isthe family introduced? What does Steinbeckdescribe first, and what connections does hemake between their living conditions and thestate of their health? Cite specific textual evidencein your response. People are more critical of their ____ selves than of their _____ selves. A)past; current. B) current; past. C) possible; impossible. D) impossible; possible. A Firm's success depends on a manager's ability to _____a. assign tasks to avoid based on a worker's weakness b. assign tasks based on a worker's strengths c. assign tasks that workers prefer Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X why is the revenue recognition principle needed? what does it demand? Which of the following code will create an index named stu_sub on the columns roll_no and subject of the stu_subjects table?A. create index stu_sub from stu_subjects(roll_no, subject);B. create index stu_subjects on stu_sub(roll_no, subject);C. create index stu_sub on stu_subjects(roll_no, subject);D. create index stu_sub on stu_subject(roll_no, subject); Let 2 8 3 W = span 1 0 2 . (a) Find a basis B for W. (b) Write down the dimension of W. Two platoons of cars are timed over a distance of 0.5km. Their flows are recorded. The first group is timed at 40 seconds, with the flow at 1350vehicles per hour. The second group take 45 seconds, with a flow of 1800vehicles per hour. Determine the maximum flow of the traffic stream. Activist investors often try to influence a board to sell off a business unit if it does not have a lot of synergy with other business units. To gain enough influence with the board, these investors usually require A mirror at an amusement park shows an upright image of any person who stands 1.4 m in front of it. If the image if three times the person's height, what is the radius of curvature? What is the meaning of "prepare the ground for the important developments with which we will be ultimately confronted"? If you have the following data abouta box of bouncy balls, about howmany bouncy balls are estimated tobe in the box?Mass of Bouncy Balls + Box = 17,342gramsMass of 45 Balls = 505 gramsMass of Box ONLY = 429 gramsApproximately, how many bouncyballs are in the box?Bouncy Balls in BoxEnter