Someone drops a book on the floor, and it makes a loud noise. At that time, you turn to look at the person who dropped the book. Turning and looking at the person who dropped the book is an example of a…

A. Phototropism

B. Response

C. Hydrotropism

D. Stimulus

Answers

Answer 1

Answer:

D

Explanation:


Related Questions

In a coffee-cup calorimeter, 100.0 g of H2O and 8.70 grams of Na3PO4 are added. The water had an initial temperature of 24.6 oC. After the dissolution of the sodium phosphate the temperature changed to  31.3 oC. 

-Was the dissolution exothermic or endothermic? Explain. 

-Calculate how much heat the water lost or gained.​

Answers

Answer:

a.) exothermic

b.) 2,800.6 J

Explanation:

In a coffee-cup calorimeter, 100.0 g of H2O and 8.70 grams of Na3PO4 are added. The water had an initial

When pouring water, isopropyl, salt water and vegetable oil, what substances will rise to the top? Which will sink to the bottom? Will they mix? Explain.

Answers

According to the concept of solubility,  pouring water in isopropyl will sink salt water will mix and vegetable oil will  rise to the top.

Solubility is defined as the ability of a substance which is basically solute to form a solution with another substance. There is an extent to which a substance is soluble in a particular solvent. This is generally measured as the concentration of a solute present in a saturated solution.

The solubility mainly depends on the composition of solute and solvent ,its pH and presence of other dissolved substance such as salts.

Learn more about solubility,here:

https://brainly.com/question/31493083

#SPJ1

i need answers for each one of these questions, or an explanation on how to find them on a calculator

i need answers for each one of these questions, or an explanation on how to find them on a calculator

Answers

Answer:

(9.03x10^-14)x(8.455x10^20)=7.634865x10^7

(5.2x10^11)/(2.10x10^-4)=2.476190x10^15

(7.67x10^12)x(3.8x10^15)=29146000000000000000000000000

(9.237x10^20)/(4.5x10^-6)=2.0526x10^26

Explanation:

Perform the following
mathematical operation, and
report the answer to the
appropriate number of
significant figures.
1204.2 +4.79613 = [ ? ]

Perform the followingmathematical operation, andreport the answer to theappropriate number ofsignificant

Answers

This problem is providing a mathematical expression which the result should be expressed with the correct significant figures. At the end, the result is 1209.0 because of the following:

Significant figures:

In science, the use of significant figures is crucial as long numbers are not necessarily required when reporting a numerical value, for that reason the importance of reporting measurements with the correct number of significant figures.

In the case of additions, we perform the normal operation as the first step:

1204.2 +4.79613 = 1208.99613

Next, we round the result to the least number of decimal places, in this case one because 1204.2 has just one decimal place, unlike the 4.79613 which has five, so that we round the 8 up to 9 and leave a 0 as the only decimal place:

1209.0

Learn more about significant figures: https://brainly.com/question/11904364

Why is lead (Pb) able to react with different elements ?

Answers

Lead (Pb) is able to react with different elements because it has a relatively low ionization energy, which means that it requires less energy to remove an electron from a lead atom compared to other elements.

Why does lead have low ionization energy?

Low ionization energy makes it more likely for lead to form compounds with other elements by giving up electrons or sharing them in covalent bonds. Additionally, lead has a relatively high atomic mass, which makes it more likely to form ionic compounds with lighter elements that have lower atomic masses.

The ability of lead to react with different elements also depends on the specific conditions under which the reaction occurs, such as temperature, pressure, and the presence of other reactants or catalysts.

Find out more on lead here: https://brainly.com/question/18110420

#SPJ1

chemistry image below

chemistry image below

Answers

A very reactive metal is image D

What is a reactive metal?

A reactive metal is a metal that readily reacts with other substances in its environment, particularly with non-metals such as oxygen, chlorine, sulfur, and nitrogen. The reactivity of a metal depends on the ease with which it can lose electrons to form positive ions.  These metals are often used in chemical reactions because of their reactivity

The metal that has been shown in the image that is attached in option D is sodium which is known to loose electron easily hence it is a reactive metal.

Learn more about reactive metal:https://brainly.com/question/20570629

#SPJ1

what is langmuir adsorption isotherm?​

Answers

\({ \red{ \underline{ \tt{Langmuir \: adsorption \: isotherm:}}}}\)

The defect of Freundlich adsorption isotherm is that it fails at high pressure of the gas.

Langmuir derived the adsorption isotherm based on the theoretical considerations. It is generally applied to chemical adsorption.

It can be expressed as

\({ \blue{ \bold{ \frac{X}{m} = \frac{AP}{1+BP}}}}\)

where,

X = mass of the gas adsorbed

M = mass of the adsorbent

P = equilibrium pressure

Find the ratio v/cv/c for an electron in the first excited state (n = 2) of hydrogen.

Answers

The answer is 0.365:100.

v/c ratio represents ratio of speed of an electron (v) to the speed of light (c).

How is the speed of an electron calculated?

The speed of an electron (v) is given by Bohr's model as-

\(v =\frac{1}{n}\; \frac{e^{2}}{4\pi \varepsilon _{0}}\times \frac{2\pi }{h}\)

Now, for the first excited state, n = 2.

e - Charge of electron = \(1.6\)×\(10^{-19}\) C

h - Plank's constant = \(6.6\)×\(10^{-34} J.s\)

ε₀- permittivity \(= 8.85\)×\(10^{-12}\)\(N^{-1}.C^{2}.m^{-2}\)

Put the above data in the formula-

\(v =\frac{1}{2}\; \frac{e^{2}}{4\pi \varepsilon _{0}}\times \frac{2\pi }{h} =\frac{1}{4}\times \frac{(1.6\times 10^{-19})^{2}}{8.85\times 10^{-12}\times 6.6\times 10^{-34}}\\ \\ =0.01096\times 10^{8} \\ \\=1.096\times 10^{6}ms^{-1}\)

Now, the speed of light, c = \(3.0\)×\(10^{8}\ m/s\)Thus, the v/c ratio for an electron in the first excited state is calculated as-

\(\frac{v}{c} =\frac{1.096* 10^{6}\ m/s }{3.0 *10^{8}\ m/s }\)= \(\frac{0.365}{100}\)

Hence, the v/c ratio = 0.365:100.

To learn more about the speed of an electron (v), visit:

https://brainly.com/question/13198566

#SPJ4

please help me, please i really need it :)

please help me, please i really need it :)

Answers

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

Select from the following list four species that can be identified as molecules. CO
Co
CO2
C
Ar
O2
CH3OH

Answers

To select four species that can be identified as molecules from the given list, you should look for species that are composed of two or more atoms chemically bonded together. The correct options are:

1. CO (Carbon monoxide) - A molecule consisting of one carbon atom and one oxygen atom bonded together.
2. CO2 (Carbon dioxide) - A molecule consisting of one carbon atom and two oxygen atoms bonded together.
3. O2 (Oxygen) - A diatomic molecule consisting of two oxygen atoms bonded together.
4. CH3OH (Methanol) - A molecule consisting of one carbon, four hydrogen, and one oxygen atom bonded together.

Your answer: Four species that can be identified as molecules from the list are CO, CO2, O2, and CH3OH.

To know more about Carbon monoxide:

https://brainly.com/question/10193078

#SPJ11

What measurements should you use for large amounts of energy transfer

Answers

You should use the joules (J) unit of measurement.

Calculate the maximum mass of aluminium which can be extracted from 10 kg of
aluminium oxide

2AlO3+ 3C ----->4Al + 3CO2

Answers

Answer:

Hrishikesh. bshjsjbd. jwjjja

Which object is an insulator?

A. Iron

B. Copper

C. Plastic

D. Salt water ​

Answers

Answer:

c. plastic is an insulator

Explanation:

a and b are metals which are conductors and d contains water which is also a conductor

What’s the formula for sodium oxide

Answers

The formula of sodium oxide is Na2O .

Answer:

The answer to this is Na2O

Which of the following is the conjugate base of HPO42-?

Which of the following is the conjugate base of HPO42-?

Answers

Answer:

A. PO4^3-

Explanation:

took the quiz on a pex

The conjugate base of HPO₄²⁻ is PO₄³⁻. Therefore, option (A) is correct.

What is the Bronsted-Lowry concept?

The Bronsted-Lowry concept can be explained as an acid-base reaction where base and acid react with each other and by an exchange of proton acid, forms its conjugate base and the base generates its conjugate acid.

The Bronsted-Lowry theory is an extended version of Arrhenius's theory of acid-base. According to this concept, acid can be defined as a substance that donates a hydrogen ion or a proton and produces its conjugate base and the base can be defined as a substance that accepts a proton and creates its conjugate acid.

Bronsted-Lowry acid in the dissociation form can be represented as:

Acid   ⇄   Conjugate base +   H⁺

The conjugate base of Bronsted-Lowry acid HPO₄²⁻ can be represented as follows:

HPO₄²⁻   ⇄  PO₄³⁻ +   H⁺

Therefore, PO₄³⁻ is the conjugate base of the Bronsted-Lowry acid HPO₄²⁻​.

Learn more about the Bronsted-Lowry concept, here:

brainly.com/question/14407412

#SPJ2

Assuming a car (with a 70-L) gas tank can hold approximately 50,000 (5.00 * 10^4) g of octane(C8H18) or 50,000 (5.00 * 10^4) g of ethanol (C2H6O). How much carbon dioxide (CO2), in grams, is produced in one tank of gas from the combustion of each amount?

Answers

Answer:

- From octane: \(m_{CO_2}=1.54x10^5gCO_2\)

- From ethanol: \(m_{CO_2}=9.57x10^4gCO_2\)

Explanation:

Hello,

At first, for the combustion of octane, the following chemical reaction is carried out:

\(C_8H_{18}+\frac{25}{2} O_2\rightarrow 8CO_2+9H_2O\)

Thus, the produced mass of carbon dioxide is:

\(m_{CO_2}=5.00x10^4gC_8H_{18}*\frac{1molC_8H_{18}}{114gC_8H_{18}}*\frac{8molCO_2}{1molC_8H_{18}}*\frac{44gCO_2}{1molCO_2} \\\\m_{CO_2}=1.54x10^5gCO_2\)

Now, for ethanol:

\(C_2H_6O+3O_2\rightarrow 2CO_2+3H_2O\)

\(m_{CO_2}=5.00x10^4gC_2H_6O*\frac{1molC_2H_6O}{46gC_2H_6O}*\frac{2molCO_2}{1molC_2H_6O}*\frac{44gCO_2}{1molCO_2} \\\\m_{CO_2}=9.57x10^4gCO_2\)

Best regards.

Choose the common intermolecular forces involved between dye molecules and fabric fibers. Dipole-dipole interactions London forces Hydrogen bonding Olonic interactions Question 3 6 pts Identify the fibers you are analyzing in your test fabric Bamboo Wool Linen O Cotton 0 Nitrile Silk Polyester 0 Tencel O etate Nylon Rayon 그 Acrylic

Answers

The common intermolecular forces involved between dye molecules and fabric fibers include dipole-dipole interactions, London forces, and hydrogen bonding.

The fibers that are mentioned in the test fabric are bamboo, wool, linen, cotton, nitrile, silk, polyester, Tencel, acetate, nylon, rayon, and acrylic. However, it is not specified which fibers are being analyzed for the intermolecular forces.

Intermolecular forces are the forces of attraction or repulsion that occur between molecules. These forces determine many of the physical properties of materials, including their melting and boiling points, viscosity, and solubility. When dyes are applied to fabric, the intermolecular forces between the dye molecules and the fabric fibers play a critical role in determining how well the dye adheres to the fibers and how well it resists fading.

Learn more about intermolecular forces here:

https://brainly.com/question/17111432

#SPJ4

1CO₂ (g) + 1C (s) → 2CO (g)
Keq =

Answers

Answer:

the equation is balanced

Which of these is an example of a physical change?

Answers

Answer:

Their isn't your examples but I will give you mine

Freezing, Evaporation and so on.

pls say the 5 methods of preventing rusting of iron

Answers

Explanation:

Corrosion of iron is called as rusting. Rusting is oxidation of iron in the presence of oxygen and water and leads to formation of hydrated ferric oxide.

Methods to prevent rusting are :

1. Application of paint: It prevents the direct exposure of metal to atmosphere.

2. Application of oils or grease: It creates a barrier between the metal and atmosphere.

3. Galvanization : It is coating of iron with more active metal zinc so that zinc gets oxidized and protects iron.

4. Cathodic protection : It involves connecting iron to a more active metal which loses electrons on behalf of iron and thus protects iron by rendering it as cathode.

5. Coating with wax tapes: It prevents the direct exposure of metal to atmosphere.

A student was adding soda and vinegar in a bottle they then put a balloon on top of the bottle immediately after adding them together the student observed that the balloon inflated and got larger The student then predicted that the chemical reaction between the vinegar and the baking soda had created a brand new matter and would have more mass at the end of the reaction would you agree with the student’s prediction or not Explain your answer

Answers

Answer:

They then put a balloon on top of the bottle immediately after adding them together. The student observed that the balloon inflated and got larger.

Explanation:

Btw brainliest me plss

Answer:

The student's prediction is wrong.  Mass cannot be spontaneously created.

Explanation:

Sorry, but all the other answers are wrong. They didn't even come close to answering your question. This question concerns ourselves with the law of mass conservation. This states that, in a reaction, the total mass of the reactants must equal the total mass of products formed after the reaction. For instance, if the mass of the reactants both weighed 5 grams, then the products, if you measured their weight afterwards, would be 5 grams. The reaction does not generate new mass at the end of the reaction, this cannot be done for any reaction, let alone this one. Thank you!

How many days will pass between a new moon and a full moon?

Answers

Answer:

30

Explanation:

im smart

Answer:

The longest duration between full moon to new moon (or new moon to full moon) lasts about 15 days and 14.5 hours, while the shortest duration between full moon to new moon (or new moon to full moon) lasts only about 13 days and 22.5 hours. New Moon appears higher on summer solstice than on winter solstice.

Gases behave most ideally at ____________ temperatures and ___________ pressures.

Answers

Low pressures and high temperatures are the optimal conditions for gas behaviour. The ideal gas law \(PV = nRT\) states that ideal gases must conform to this law.

It is only feasible if the gas is made up of several freely moving point particles that do not interact with each other and have a very small total volume. An ideal gas is one in which all collisions between atoms or molecules are completely elastic and in which there are no intermolecular attraction forces. It can be compared to a collection of perfectly hard spheres that collide but do not interact with one another in any other way. The molecules of perfect gases are not attracted to one another or repel one another.

Learn more about Ideal gas here:

https://brainly.com/question/27870704

#SPJ4

How are particles in air arranged in a compression?

And how are particles in air arranged in a rarefaction?

(Use science terminology please)

Answers

In a compression, the particles in the air are arranged closer together than in a normal state, resulting in an increase in air pressure.

In a rarefaction, the particles in the air are arranged further apart than in a normal state, resulting in a decrease in air pressure.

What is compression?

The increase in pressure is due to the collisions between the particles becoming more frequent, which leads to an increase in the number of particles in a given volume. This can occur due to the presence of a sound wave, for example, which causes alternating regions of high and low pressure in the air.

What is rarefaction?

This occurs because the particles are moving farther away from each other due to a decrease in the number of collisions between them. This can also occur due to the presence of a sound wave, where the alternating regions of high and low pressure cause the particles to move back and forth, resulting in areas where the particles are further apart than usual.

To know more about particles, visit:

https://brainly.com/question/11254035

#SPJ1

Complete question is: In a compression, the particles in the air are arranged closer together than in a normal state, resulting in an increase in air pressure and In a rarefaction, the particles in the air are arranged further apart than in a normal state, resulting in a decrease in air pressure.

How many grams of BeF2 are present in 655 ml of a 0.442 m solution of Bef2

Answers

Answer:

13.6 g

Explanation:

The mass of BeF₂ present in 655 ml of a solution that is 0.442 M is equal to 13.82 g.

What is the molarity?

We can calculate the concentration of a solute in a solution in terms of molarity, molality, and normality.

The molarity of a particular solution can be determined from the number of moles of a solute per unit volume of the solution.

The Molarity of the particular solution can be determined from the mathematical formula mentioned below:

Molarity = Moles/Volume of the Solution

Given, the molarity of BeF₂ solution = 0.442 M

The volume of the BeF₂ solution, V = 655 ml = 0.655 L

The molar mass of the BeF₂, M = 47.01 g/mol

Molarity of BeF₂ solution = m/(M × V)

0.442 = m/ (47.01 × 0.655)

m = 13.82 g

Therefore, 13.82 g of BeF₂ is required for the given solution.

Learn more about molarity, here:

brainly.com/question/8732513

#SPJ2

25. The half-life of radioactive strontium- 90 is 29 years, In 1960, radioactive strontium-90 was released into the at. mosphere during testing of nuclear weapons, and was ab. sorbed into people's bones. How many years does it take

Answers

It takes approximately 100.704 years (since 1964) until only 9 percent of the original amount of radioactive strontium-90 absorbed remains.

The half-life of radioactive strontium-90 is given as 29 years, which means that every 29 years, the amount of radioactive strontium-90 is reduced by half.

To find the number of years it takes until only 9 percent of the original amount remains, we can set up the following equation:

(0.5)^(t/h) = 0.09

Where:

t represents the number of years since 1964 (the initial time),

h represents the half-life of 29 years, and

0.09 represents 9 percent.

Let's solve for t:

(0.5)^(t/29) = 0.09

Taking the natural logarithm (ln) of both sides:

ln[(0.5)^(t/29)] = ln(0.09)

Using the logarithmic property: ln(a^b) = b × ln(a):

(t/29) × ln(0.5) = ln(0.09)

Dividing both sides by ln(0.5):

t/29 = ln(0.09) / ln(0.5)

t = 29 × (ln(0.09) / ln(0.5))

Using a calculator, we can find the value of t:

t = 29 × (-2.40794561 / -0.69314718)

t = 100.704

Learn more about radioactive -

brainly.com/question/23759636

#SPJ11

what can the shape of a molecule affect?

what can the shape of a molecule affect?

Answers

Answer:

Comrades it's B

Explanation:

You can trust me or not but it will be your fauit if you fail so i say trust me comrade. Glroy to Alpha!

A molecule's shape greatly influences the polarity of the compound, the molecular structure has an impact on molecular characteristics. The shape of a molecule affect the molecule's function. Therefore, option B is correct.

What is molecule ?

Based on the environment, the term may or may not include ions that meet this requirement. A molecule is a collection of two or more atoms held together by the attractive forces known as chemical bonds.

Molecule shape play a key role in anticipating how one molecule may interact with another, as well as in determining macroscopic features like melting and boiling points.

Polar substances have higher boiling and melting temperatures, tend to dissolve in other polar compounds, and can either form solids or liquids.

Thus, option B is correct.

To learn more about the molecule, follow the link;

https://brainly.com/question/19556990

#SPJ5

I need to learn how to balance this equation, but I am having trouble with it. Can you help me?__Zn + __HC2H3O2 → __Zn(CH3COO)2 + __H2

Answers

To balance a equation, we need to have the same number of atoms of each elements on both sides of the chemical reaction (reactant and product side).

I rewrote this substance(Zn(CH3COO)2) for better understanding.

__Zn + __HC2H3O2 → __Zn(C2H3O2)2 + __H2

Reactant side unbalanced:

Zn - 1

H - 4

C - 2

O - 2

Products side unbalanced:

Zn - 1

C - 4

H - 8

O - 4

Obs: when there is a part inside the parentheses, all the atoms are multiplied by the number outside the parentheses.

Now let's balance the equation changing the stoichiometric coefficient.

Zn + 2 HC2H3O2 → Zn(C2H3O2)2 + H2

Reactant side:

Zn - 1

H - 8

C - 4

O - 4

Product side:

Zn - 1

H - 8

C - 4

O - 4

Now the equation is balanced.

Answer: Zn + 2 HC2H3O2 → Zn(C2H3O2)2 + H2

How can we see all four colors from a hydrogen gas dischrarge tube simutaneously?

Answers

There are thousands of hydrogen atoms so together they can let off or group up to form all four colors.

Hydrogen is a chemical element with the symbol H and atomic number 1. Hydrogen is the lightest element. Under standard conditions, hydrogen is a diatomic molecular gas of the formula H2. It is colorless, odorless, tasteless, non-toxic, and highly flammable.

Hydrogen is an energy carrier that can be used to store, transfer, and deliver energy generated from other energy sources. Hydrogen fuel can be produced today by several processes. The most commonly used methods today are natural gas reforming (a thermal process) and electrolysis. It is found in the Sun and most stars, and the planet Jupiter is composed primarily of hydrogen. On Earth, hydrogen is most abundant as water. As a gas in the atmosphere, it is present in trace amounts, less than 1 ppm by volume.

Learn more about  hydrogen   here

https://brainly.com/question/19813237

#SPJ4

PART OF WRITTEN EXAMINATION:
Oxidation
A) increases the negative charge of an atom or compound
B) decreases the positive charge of an atom or compound
C) is independent of reduction
D) occurs when the electrons are lost from an atom or compound

Answers

Oxidation D) occurs when the electrons are lost from an atom or compound. Oxidation refers to a chemical reaction where there is a transfer of electrons from one substance to another.

During oxidation, the substance that loses electrons is known as the reducing agent while the substance that gains electrons is known as the oxidizing agent. When an atom or compound loses electrons during oxidation, it becomes more positively charged, and this results in a decrease in its negative charge.

For example, when iron rusts, it undergoes oxidation as it loses electrons to oxygen. The iron atoms lose their electrons, and as a result, they become positively charged. This causes the iron compound to have a more positive charge than it did before the oxidation process.

In summary, oxidation occurs when electrons are lost from an atom or compound, which results in a decrease in the negative charge of the compound or atom.

Learn more about oxidizing agent here:

brainly.com/question/10547418

#SPJ11

Other Questions
an anatomically based approach to intralesional corticosteroid injection for eyelid capillary hemangiomas Which is an example of a destructive force that shapes Earth's surface?FREEO cloudsO volcanoesO wind erosionO sediment deposits How is the city alive? In the city we became Select the correct answer. what is down payment with regard to buying a house? a a part of the purchase price pald in installments ob. a part of the purchase price pald in cash oc an interest on the purchase price a field ecologist is studying a sage plant that grows wild in southern california. She notices the characteristic uniform dispersion of the plants in all of the quadrats she has mapped out. What is a liley explanation for this dispersion pattern which of the following contributed to population migration from the yellow river basin south to the yangzi river? The common characteristic of American law is that it creates: _____, _______, and ________ that reflect accepted views of the society. (Choose all correct answers) Organisms in the same ecosystem are all __________. A) interrogative B) interdependent C) intermediate D) interceptive E) inter-zonal Two polynomials P and D are given. Use either synthetic or long division to divide P(x) by D(x), and express P in the form P(x) = D(x) Q(x) + R(x).P(x) = x3 2x + 4, D(x) = x + 1P(x) = a router is blasting out ip packets whose total length (data plus header) is 1024 bytes. assuming that packets live for 10 sec, what is the maximum line speed the router can operate at without danger of cycling through the ip datagram id number space? A clerk spends 35% of his time packaging parts and 65% of his time numbering parts. Assuming his salary is $30,000, calculate the amount of resource cost assigned to the numbering activity. describe the four protein chains that make up the immunoglobulin monomer, and draw a typicalmonomer immunoglobulin in the box below. label the variable regions and constant regions 45. hope often sits for hours in extremely rigid positions; during these times she seems to lose contact with the external world and does not respond to people who try to speak to her. at other times she becomes extremely hyperactive and rambles on incoherently. hope's symptoms are most consistent with those seen in Piaget's first stage of moral developmentin which children view rules as being handed down by authoritiesas having a permanent existenceunchangeablerequiring strict obedienceheteronomous moralitysocial cooperationmorality of cooperation what jeans brand should i buy from? In the example about the French coast guard in this section, suppose you are a spy watching the boat and listening in on the radio messages from the boat. You collect the following data: When the actual position is [ 3 42 ] [342], they radio [ 54 171 ] [54171]. When the actual position is [ 4 41 ] [441], they radio [ 57 168 ] [57168]. Can you crack their code (i.e., find the coding matrix), assuming that the code is linear? If a company learns that a competitor will introduce a new cake mix, it may use a blank______ as a sales promotion to encourage its customers to stock up on its cake mixes and make the new launch less effective. multiple choice question. product placement premium sample deal What is an emphasis or accent placed on a syllable in speech? Which of the following BEST describes sports protective equipment? A. Equipment should be used during games, but not practice. B. There's no "right" way to use protective equipment. C. You should use only protective equipment that is comfortable. D. Protective equipment is a key part of safe sports. Please select the best answer from the choices provided. A B C D a truck weighing 30,000 lb is traveling at 50 mph. the driver hits the brakes to bring the truck to a halt in 300 feet. what's the braking force (in lb) required to bring the truck to halt?