the general term used to designate problems resulting from damage to or disease of any components of a motor unit incluiding the somatic motor neuron neuromuscular junction and muscle fiber is

Answers

Answer 1

The general term used to designate problems resulting from damage to or disease of any components of a motor unit, including the somatic motor neuron, neuromuscular junction, and muscle fiber, is known as 'motor unit pathology'.

Neuromuscular disorder is a condition that affects muscles, nerves, and their interaction. It can cause muscle weakness, twitching, pain, and cramps, as well as breathing or swallowing difficulties. There are a variety of neuromuscular disorders, each with its own causes, symptoms, and treatments. Some of the most common neuromuscular disorders include muscular dystrophy, amyotrophic lateral sclerosis, multiple sclerosis, and myasthenia gravis. A muscle disorder refers to any disorder that affects the functioning of the muscles in the body.

This may involve a range of diseases, from myopathies, which are disorders that affect the muscles themselves, to neuromuscular disorders, which affect the interaction between the muscles and nerves that control them. As a result, muscle disorders may cause muscle pain, weakness, and stiffness, as well as a range of other symptoms.

To know more about Neuromuscular junction please visit :

https://brainly.com/question/12905147

#SPJ11


Related Questions

If the diploid number of chromosomes in a cat is 38, then the haploid number would be?

Answers

If the diploid number of chromosomes in a cat is 38, then the haploid number would be 19.

Somatic cells are created through a method of cell division known as mitosis. They possess two copies of every chromosome, one from an individual's mother and one from their father. Cells having two copies of each chromosome are termed as diploid (2n).

Gametes such as sperm and egg cells are created through meiosis, which is a distinct method of cell division which leads to the formation of cells, which contain just one copy of each chromosome. These cells are termed as haploid (n).

Since, 2n = 38, therefore n = 19.

To learn more about chromosomes here

https://brainly.com/question/1596925

#SPJ4

Flowers shaped for their pollinators, specific camouflaged color patterns of animals, and a beaver's enormous front teeth for gnawing are all examples of

Answers

Flowers shaped for their pollinators, specific camouflaged color patterns of animals, and a beaver's enormous front teeth for gnawing are all examples of adaptation

What is adaptation ?

The modification of an organism to its environment in order to increase its chances of survival is known as evolutionary adaptation, or simply adaptation.

A living thing can modify itself to fit its surroundings. A plant growing at a higher altitude, for instance, might change its metabolism or the types of nutrients it needs to thrive. Another perspective on adaptation is genetic.

An animal's morphological or behavioural characteristics that aid in their better survival in their environment are referred to as adaptations. In other words, an adaptation is something a person does or has on their body that facilitates locating food, water, partners, and shelter.

Learn more about Adaptation here:

https://brainly.com/question/29594

#SPJ4

In the arm the distal segment has a higher density than the proximal segment. T/F

Answers

False. The density of the arm is typically higher in the proximal segment (closer to shoulder) and decreases as it moves towards the distal segment (closer to the hand).

This is because the muscles in the proximal segment are generally larger and more complex, requiring more blood vessels and nerve fibers. Additionally, the bones in the proximal segment are thicker and denser to provide more support and stability for the upper arm. In contrast, the distal segment contains smaller muscles and bones, which require less support and have lower densities. Therefore, it is more accurate to say that the proximal segment has a higher density than the distal segment in the arm.

To learn more about proximal click here https://brainly.com/question/28903489

#SPJ11

what is the full form CFCs ? ​

Answers

Answer:

ChloroFlouroCorbon

Explanation:

It is a gas most found in air conditioners, refrigerators.

Answer:

Chloroflourocarbons

Explanation:

C- Chloro

F- Flouro

C- Carbons

Hope it helps,

If so, please mark my answer as brainliest :-)

Which of the following statements BEST describes vitamins A, D, E, and K? essential micronutrients that are not soluble in water nonessential macronutrients that are soluble in water nonessential micronutrients that are soluble in water essential macronutrients that are not soluble in water

Answers

Answer:

Fat Soluble

Explanation:

fat-soluble: A,D,E,K - water-soluble: B vitamins, vitamin C - functions: regulation of body processes

A Before prophase II begins, does the DNA in the cell duplicate itself?___________

B. During metaphase II, do homologous chromosomes pair up as in metaphase I?__________

C. How does anaphase II differ from anaphase I?_________

D. At the end of anaphase II , how many chromatids are on each side of the cell ?___

E. After cytokinesis , how many cells have been formed from the parent cell ?_______

F. Are all of the cells the same size ? _______​

Answers

Answer:

for F no

Explanation:

no cells are the same because all people ate different and can not be precisely the same as cells.

Positive Effects of Genetic Engineering Negative Effects of Genetic Engineering

Answers

Genetic engineering is considered as the process to alter the structure of genes including it's nature in human beings, animals or foods using techniques like molecular cloning and transformation. In other words, it is the process of of modifying the genetic information by modification of the DNA.

Some benefits of genetic engineering includes:

1.Tackling and defeating diseases.

2.Getting Rid of All Illnesses in Young and Unborn Children.

3.Potential to Live Longer

4.Pest and Disease Resistance

5.Produce New Foods

Some negative impacts on genetic engineering include:

1.It may Lead to Genetic Defects.

2.Limits Genetic Diversity.

3.Reduces Nutritional Value

4.We are reducing the animals, a part of nature, as our puppets.

For more information on genetic engineering, visit:

https://brainly.com/question/29764651

#SPJ4

The diagram below shows part of the rock cycle.



Which type of rock does A represent?

Group of answer choices

Metamorphic rock

Rock formed by cooling

Rock formed by compaction

Sedimentary rock


PLEASE HELPPPPP

The diagram below shows part of the rock cycle.Which type of rock does A represent?Group of answer choicesMetamorphic

Answers

Answer:

The answer is option B - Rock formed by cooling (Igneous rock)

Explanation:

Volcanic rock (also called extrusive rock) is one type of magmatic rock (igneous rocks) and is the condensated product of extrusive magma after diagenesis and compaction, which differ greatly from sedimentary rocks in forming conditions, environments, and distribution.

thank youuuuuu
Muscles can only contract, so they occur in pairs. In the arm, the biceps muscle is a flexor-that is, it closes the limb. The triceps muscle is an extensor that opens the limb. This configuration is t

Answers

The tension in the biceps muscle T_AB can be determined as T_AB = 2W, and the magnitude of the force exerted by the forearm on the upper arm at the elbow joint C is equal to the weight of the forearm, which is 9 N.

In this scenario, the elbow joint is modeled as a simple machine, specifically a lever system. The weight of the forearm acts as the load, and the tension in the biceps muscle acts as the effort. According to the lever principle, the input force (tension in the biceps muscle) is greater than the output force (force exerted by the forearm on the upper arm at the elbow joint).

Since the weight of the forearm is given as 9 N, we can determine the tension in the biceps muscle T_AB by using the relation T_AB = 2W, which yields T_AB = 2(9 N) = 18 N. Therefore, the tension in the biceps muscle is 18 N.

The magnitude of the force exerted by the forearm on the upper arm at the elbow joint C is equal to the weight of the forearm, which is given as 9 N. This force represents the output force of the lever system at the elbow joint.

To learn more about Muscles, here

https://brainly.com/question/11087117

#SPJ4

thank youuuuuuMuscles can only contract, so they occur in pairs. In the arm, the biceps muscle is a flexor-that

Lamarck's ideas about evolution include the concept that differences among the traits of
organisms arise as a result of
O continual increases in population size.
the actions of organisms as they use or fail to use body structures.
an unchanging local environment.
the natural variations already present within the population of organisms.

Answers

What’s the question?

According to Lamark's theory of evolution, differences among the traits of

organisms arise as a result of the actions of organisms as they use or fail to use body structures.

The theories of evolution try to explain the changes that occur in living things as new species replace existing ones. There have been two main theories that seek to explain the evolution of organisms'

Darwin's theoryLamark's theory

The theory of Lamark deals with use and disuse of body parts. Body parts that are not used begin to degenerate and only appear as relics in new species. A typical example of this is the appendix in humans. Hence, according to Lamark, differences among the traits of  organisms arise as a result of the actions of organisms as they use or fail to use body structures.

Learn more: https://brainly.com/question/10062542

Which adjustment knob is used to make the initial adjustment?

Answers

Answer:

always focus first with the course adjustment and the low power objective lense

Explanation:

hope it helped

classify each of the following as an element, compound, homogeneous mixture, or heterogeneous mixture. 1.water
2.Caesar Salad
3.milk and cereal
4.Iron filings
5.blood
6.sugar
7.sand
8.sea water
9.salt
10.carbon dioxide​

Answers

Caesar Salad, milk and cereal, Blood, Sand  are heterogeneous mixture while water, sugar and salt are compounds and Iron filings is a element and Sea water is a homogeneous mixture

A pure substance with only one kind of atom makes up an element. The elements oxygen, hydrogen, and iron are examples.

A compound is a substance that is composed of two or more distinct elements that have been chemically bonded together in a specific proportion. Examples include sodium chloride, carbon dioxide, and water.

A combination of two or more substances that are evenly distributed at the molecular level is referred to as a homogeneous mixture. The mixture's composition is constant throughout. Examples include air, sugar water solutions, and saltwater.

A combination of two or more substances that are not distributed equally is referred to as a heterogeneous mixture. Visual differentiation between the various elements is possible and with time, they may settle or separate. A salad with various ingredients, soil and vinegar dressing are some examples.

Learn more about heterogeneous mixture at:

brainly.com/question/29207752

#SPJ4

A new vaccine has been developed to protect people against salmonella food poisoning
Explain how the vaccine prevents people becoming ill with salmonella food poisoning
PLEASE HELP ITS DUE TMRW

Answers

Answer:

Explanation:

I really don’t know I just wanted to write this to get the point’s because I’m new to dis app

Contains an inactive or dead form of the pathogen which makes the memory cells remember the shape of the antigens on the pathogen so when a live salmonella pathogen enters the body it will trigger a secondary response, the memory cells will trigger a quicker response and the pathogen will be destroyed quickly, without any symptoms being present

Hope this helps :))

What is the function of carbon dioxide in the atmosphere?

Answers

Answer:

To warm up the Earth.

Explanation:

Carbon dioxide in the atmosphere warms the planet causing climate change.

Carbon helps to regulate the Earth's temperature, makes all life possible,

what prevents coral reefs from surviving below the euphotic zone? group of answer choices high water density high pressure inadequate sunlight saline water damage from storms

Answers

Inadequate sunlight prevents coral reefs from surviving below the euphotic zone.

The majority of coral reefs are found nearby in shallow water. Due of this, they are particularly susceptible to the negative consequences of human activity, both directly via the exploitation of reef resources and indirectly through the effects of nearby human activities on land and in the coastal zone. The social, cultural, and economic fabric of local coastal communities is intricately intertwined with many of the human activities that harm coral reefs.

Numerous local risks to coral reefs exist, such as:

Physical harm or devastation caused by recreational overuse, coastal development, dredging, quarrying, harmful fishing methods and equipment, boat anchors and groundings, etc (touching or removing corals).

Land-based pollution that makes its way into coastal waterways There are several pollution kinds and sources from land-based activities.

1.sedimentation

2. Nutrients

3. pathogen

4. Toxic substances

To know more about euphotic zone visit:
https://brainly.com/question/18991186
#SPJ4

You have a plant that you want to show off at a party. The party happens during autumn (aka fall). Usually in autumn (aka fall) the leaves of your plant fall off. You want to delay the leaves falling off your plant until after the party. What plant hormone would you use to help keep the leaves on? ethylene O cytokinins O gibberellins auxin

Answers

Answer:

Auxins

Explanation:

Auxin is a plant hormone that has to do with both leaf and fruit fall.

pls help I AM ON A TIMERR PLEASE

pls help I AM ON A TIMERR PLEASE

Answers

Answer:

They will move inside the cell cos the concentration inside the cell is too low

Explanation:

hope it helps

Answer:

2nd option

Explanation:

After a night of drinking too much alcohol, a person will rely on which organelle to help detoxify and recover?Select one:a. lysosomes.b. Golgi apparatus.c. smooth endoplasmic reticulum.d. peroxisomes.e. mitochondrion

Answers

Smooth endoplasmic reticulum (SER) is responsible for detoxifying various substances, including alcohol. The enzymes present in the SER can metabolize alcohol and convert it into less toxic compounds. After a night of heavy drinking, the liver's SER works hard to detoxify the body and help the person recover from the effects of alcohol. The correct option is C

What is alcohol ?

Alcohol also known as ethanol, is a psychoactive substance that is commonly used as a recreational drug. It is produced by the fermentation of sugars and starches by yeast and other microorganisms.

Alcohol has a range of effects on the body such as :

Mild euphoriaReduced inhibition Impaired judgment Impaired motor coordination

Therefore, the correct option is C

Learn more about  alcohol here : brainly.com/question/982656

#SPJ1

How does noise affect a signal?

Answers

Explanation:

Noise is an unwanted signal which interferes with the original message signal and corrupts the parameters of the message signal. This alteration in the communication process, leads to the message getting altered. It is most likely to be entered at the channel or the receiver.

Sunspots are dark areas on the surface the Sun.They mark strong magnetic fields, and more sunspots indicate that the Sun is more active and is releasing more energy. The following graph presents the average daily number of sunspots from 1900 through
1944. Each data point is the average for one month.

Answers

So why didn’t you look the answer up
Look the answer up on google trust me you will find what your looking for

Which of the following shows the correct sequence of the cell cycle

Answers

Answer:

C is the correct answer. G1, S, G2 are the interphase, then comes mitosis and then cytokinesis

How is a brain injury classified?

as an injury of the peripheral nervous system
as an injury of the central nervous system
as an injury of the autonomic nervous system
as an injury of the somatic nervous system

Answers

Answer:

As an injury of the central nervous system.

Explanation:

Peripheral nervous system is the nervous system outside the brain and spinal cord. The central nervous system consists of the brain and spinal cord. The autonomic nervous system is a control system that acts largely unconsciously and regulates bodily functions, such as the heart rate, digestion, respiratory rate, and more. The somatic nervous system is the part of the peripheral nervous system associated with the voluntary control of body movements via skeletal muscles. Therefore, central nervous system is your answer!

Hope this helps :3

Answer:

Brain injury would be classified as an injury of the central nervous system.

Select the type of Cell Transport shown in the picture.
Choose

Select the type of Cell Transport shown in the picture.Choose

Answers

Answer:

Osmosis

Explanation:

Osmosis: The movement of water from an area of high concentration to a low concentration through a partially permeable membrane.

_______________________ is the science of heredity and it seeks a precise explanation of the biological structures and mechanisms that determine what is inherited and how it is inherited.

Answers

The science of heredity, also known as genetics, is a field that explores the mechanisms and structures involved in the inheritance of traits from parents to offspring. Biological structures such as DNA, genes, and chromosomes play a crucial role in determining what is inherited and how it is inherited.

DNA, the genetic material that is present in every cell of an organism, contains the instructions for the development and function of the organism. Genes, which are segments of DNA, code for specific traits that are passed down from one generation to the next. Chromosomes, which are structures made up of DNA and proteins, carry genes and are responsible for the segregation and distribution of genetic material during cell division. Inherited traits can be influenced by various factors, including environmental factors, but genetics provides a framework for understanding the fundamental mechanisms that govern heredity.

To know more about DNA

https://brainly.com/question/2131506

#SPJ11

the protein directly responsible for creating a low ph in the stomach is ____ a. CFTR b. Na+/K+ ATPase c. Carbonic anhydrased. H+/K+ATPase

Answers

The protein directly responsible for creating a low pH in the stomach is **d. H+/K+ ATPase**.

The H+/K+ ATPase, also known as the proton pump, is located in the parietal cells of the stomach lining. It plays a crucial role in the secretion of gastric acid (hydrochloric acid, HCl) into the stomach lumen.

This protein actively transports hydrogen ions (H+) from the cytoplasm of the parietal cells into the stomach lumen, while simultaneously exchanging them with potassium ions (K+).

This process is energized by ATP hydrolysis, hence the name ATPase.

By pumping hydrogen ions into the stomach, the H+/K+ ATPase creates an acidic environment necessary for the digestion of food and activation of enzymes.

The low pH in the stomach aids in the breakdown of proteins, kills harmful microorganisms, and provides an optimal environment for the activation of pepsinogen into its active form, pepsin.

Therefore, the H+/K+ ATPase is the protein directly responsible for creating a low pH in the stomach.

To know more about ATPase refer here

brainly.com/question/14022346#

#SPJ11

Muốn có vitamin D tránh loãng xương, còi xương ta cần phải là gì:

Answers

Answer:

Phơi nắng vào buổi sáng.

Answer:

chúng ta phải bổ sung thêm vitamin D qua các sản phẩm như lòng đỏ trứng, cá, sữa.

Explanation:

What do scientists use Punnett
Squares for?

A. Finding the possible traits of parent plants

B. Finding the possible traits of ancient
organisms

C. Finding the possible traits of recessive genes
only

D. Finding the possible traits of the offspring of
two plants whose genes are known

Answers

Answer:

D. Finding the possible traits of the offspring of two plants whose genes are known

Explanation:

Punnett Squares are used by applying both of the genes of the parent organisms to find the possible traits of the offspring.

what is the biological role of hemoglobin? (giving brainly for a well structured explanation)

Answers

Answer:

Hemoglobin is essential for transferring oxygen in your blood from the lungs to the tissues. Myoglobin, in muscle cells, accepts, stores, transports and releases oxygen.

Explanation:

hope this help:)

Answer:

the answer is b I got a 100

Find the amino acid chain that forms from the mRNA sequence DNA
sequence below.
GATCGATACCATTCGGCGCATACTTCG

Answers

Answer:

mRNA= CUA GCU AUG GUA AGC CGC GUA UGA AGC

Amino acid chain=LEU ALA MET VAL SER ARG VAL STOP SER

Explanation:

Find the START codon (AUG). Start reading in groups of 3 and check against a codon table. When you get to a STOP (UAA, UAG, UGA) you’ve got that protein strand’s sequence.

What’s an example of a mutualism ecological relationship in a tundra biome?

Answers

Answer:

Answer. Mutualism: One example of symbiotic mutualism in the tundra biome involves lichens. Lichen does look like moss but actually represents a symbiotic relationship between fungi and algae or algae. The fungus "eats" the sugar in the algae for photosynthesis and the algae receives protection from the fungus.

Other Questions
A person assembling a tool one week after reading the instructions can remember the first and last steps of the procedure but not the middle ones. This best illustrates which of the following?Encoding failureSocial facilitationRetrograde amnesiaRepressionThe serial position effect An insured purchased a noncancellable health insurance policy 1 year ago. Which of the following circumstances would NOT be a reason for the insurance company to cancel the policy?The insured is in an accident and incurs a large claimThe insured does not pay the premium.The insured reaches the maximum age limit specified in the policy.Within two years of the application, the insurer discovers a misrepresentation. 64. If the economy is normal, Charleston Freight stock is expected to return 15.7 percent. If the economy falls into a recession, the stock's return is projected at a negative 11.6 percent. The probability of a normal economy is 80 percent while the probability of a recession is 20 percent. What is the variance of the returns on this stock? The Mongol conquest of China brought about which result?A the surrender of Japan to Kublai KhanB the establishment of the Yuan DynastyC Hinduism's rise as the dominant religion in ChinaD decreased trade between Asia and Europe How does RNA polymerase initiate transcription in E coli? The pH of a 0.74 M solution of alloxanic acid (HC4H3N2O5) is measured to be 3.39.Calculate the acid dissociation constant Ka of alloxanic acid.Be sure your answer has the correct number of significant digits. A machine with a cost of $134,000 and accumulated depreciation of $89,000 is sold for $52,000 cash. The amount that should be reported as a source of cash under cash flows from investing activities is:Multiple Choice$7,000.$45,000.$52,000.Zero. This is a financing activity.Zero. This is an operating activity.In preparing a company's statement of cash flows for the most recent year, the following information is available:Loss on the sale of equipment$15,500Purchase of equipment160,000Proceeds from the sale of equipment141,000Repayment of outstanding bonds94,500Purchase of treasury stock69,500Issuance of common stock103,500Purchase of land130,000Increase in accounts receivable during the year50,500Decrease in accounts payable during the year82,500Payment of cash dividends42,500Net cash flows from investing activities for the year were:Multiple Choice$282,000 of net cash used.$149,000 of net cash provided.$149,000 of net cash used.$243,500 of net cash provided.$133,500 of net cash used.A company had net cash flows from operations of $131,000, cash flows from financing of $352,000, total cash flows of $533,000, and average total assets of $3,160,000. The cash flow on total assets ratio equals:Multiple Choice4.1%.4.3%.16.9%.17.0%.24.6%. please helpThe linear model represents the height, f(x), of a water balloon thrown off the roof of a building over time, x, measured in seconds: Consider an oligopolistic market with 3 identical firms, all three making a homogeneous product. The inverse demand for this product is P(Q) = 3, 000 6Q where Q is the market quantity. The marginal cost of production is equal to the average cost and is identical for all firms and given by c = 2, 000.(a) Solve for the best response function for each of the three firms.(b) Calculate the Nash equilibrium output, price and profits of each firm using quantity as the strategic variable (i.e. assuming firms choose quantities).(c) Compute the Lerner index for each firm.(d) Assume two of the firms merge. Assume that the merged firm has marginal cost 1,600. What is the profit of the merged firm? (e) Given your answer to pard (d), would the firms want to merge? Explain. (f) Would the firm that was not part of the merger benefit from the merger? Explain. Is the group of words in bold a phrase or a clause?Did you know that tarantulas can survive for as long as two years without food? At cheap more super market,1 litre of fruit juice costs R25 and 1,5 litres cost R34 Which juice is cheaper. Show your calculation A ____________ is one type of malicious software program that disrupts or destroys existingprograms and networks.a.Computer wormb.Computer virusc.Trojan horsed.Cyber bully create a formula with structured references to calculate the percentage of the Sticker Price in column E. Columns C and D have the sticker price and sale price, respectively. Malcolm X was assassinated. By members of the 1. Use the data in hprice1.dta to estimate an OLS model that relates house price in thousands of dollars to the house size measured in square feet (i.e., the variable sqrft) and the number of bedrooms in the house (bdrms). Write it the result in equation form.2. What is the estimated increase in price for a house with one more bedroom, holding square footage constant?3. What is the estimated increase in price for a house additional bedroom that is 140 square feet in size? Compare this to your answer in question two above.4. What percentage of the variation in price is explained by square footage and number of bedrooms?5. The first house in the sample has sqrft=2,438 and bdrms=4. Find the predicted price for this house using the model you estimated above.6. The actual selling price of the first house in the sample was $300,000 (i.e. price= 300). Find the residual for this house. Does it suggest that the buyer underpaid or overpaid for the house? the three bins represent three important properties of stars. What are the items that we must measure in orrder to determine each property into the three bins.Luminosity ________Surface Temperature________ Mass________ A small open economy with perfect capital mobility is characterized by all of the following except that: A) its domestic interest rate always exceeds the world interest rate. B) it engages in international trade. C) its net capital outflows always equal the trade balance. D) its government does not impede international borrowing or lending, Identify a true statement about how the growing power of the Republican Party in Texas has affected the executive branch of Texas government.A. It has weakened the executive branch because Republican candidates who are elected to statewide executive offices openly challenge long-serving Democrats holding other executive offices.B. It has weakened the executive branch by increasing differences in the plural executive because Republican candidates elected to executive offices tend to be moralistic conservatives who tend to turn off traditional and individualistic conservative voters.C. It has strengthened the executive branch by virtually eliminating divisions in the plural executive because Republican nominees who emerge from the primaries for statewide offices are mostly in agreement on what policies they want to pursue.D. It has strengthened the executive branch because Republican legislators are liberal conservatives who respect the Governor's authority and follow his or her agenda. TRUE/FALSE. Corporations are legally formed by filing articles of organization with the state in which the corporation will be created. Lewis must communicate important policy changes to his sales reps on the road. He would also like their active participation and immediate feedback. The proper medium for this message would be which of the following?a. A virtual meetingb. Posting an announcement on the office bulletin boardc. Forwarding a letter or e-maild. One that targets the secondary audience