The illustrations below show the creation of two different mixtures. Based on this information,decide which conclusion is supported by the evidence you have been given. Only Mixture A resulted in a chemical reaction.Only Mixture B resulted in a chemical reaction.Both Mixture A and Mixture B resulted in chemical reactions.Neither Mixture A nor Mixture B resulted in a chemical reaction.

Answers

Answer 1

Answer:

Explanation:

A restaurant makes three batches of tomato soup using the recipe shown.

Each batch contains a different amount of soup.

Drag numbers to show how much of each ingredient should be used in each batch of tomato soup.

18 of the soup is chicken stock.

14 of the soup is cream.

58 of the soup is tomato puree.

CLEAR CHEC


Related Questions

the red cells found in lead poisoning characteristically exhibit coarse granules composed of _______ that are reported as _______. group of answer choices

Answers

The red cells found in lead poisoning characteristically exhibit coarse granules composed of excess iron deposits that are reported as basophilic stippling, option D is correct.

In lead poisoning, the red blood cells (erythrocytes) can exhibit coarse granules known as basophilic stippling. These granules are composed of excess deposits of iron within the cells. Basophilic stippling refers to the appearance of small, dark-blue or purple granules distributed throughout the red blood cells when stained and observed under a microscope.

Precipitated hemoglobin is not associated with lead poisoning, and Pappenheimer bodies are iron-containing granules seen in certain conditions like sideroblastic anemias, option D is correct.

To learn more about basophilic follow the link:

https://brainly.com/question/31834968

#SPJ4

The complete question is:

The red cells found in lead poisoning characteristically exhibit coarse granules composed of _______________ that are reported as ______________

A. Precipitated hemoglobin; Pappenheimer bodies

B. Aggregated ribosomes; basophilic stippling

C. Nuclear fragments; Pappenheimer bodies

D. Excess iron deposits; basophilic stippling

Programming problem: Suppose a population of wolves and rabbits that grow and decrease in numbers based on the following dynamics Given X1 rabbits a new one is born at rate bx1. Given X2 wolves_ one dies of hunger with rate dxz: Given X1 rabbits and x2 wolves; rabbit is eaten by wolf and a new wolf is born with rate qx1x2: Use this description of the transition rates {Rxy}x,yEs to simulate the associated continuous time Markov chain X = (Xt^1, Xt^(2)t≥0 on S = NxN where Xt^(1) and Xt^(2) are the numbers of rabbits and wolves at time respectively. Plot three phase plots X^(1) on x-axis and X^(2) on Y-axis): (1) one in which the wolf population dies out; (2 one in which the rabbit population dies out and one in which the populations move up and down together: You may select any time duration and b,q,d > 0 separately for each ofthe three plots But start with 1000 wolves and 1000 rabbits in each of the three simulations'

Answers

To simulate the continuous time Markov chain for the dynamics of the wolf and rabbit population, we can use the Gillespie algorithm. This algorithm simulates the time evolution of the system by randomly selecting a reaction to occur and updating the populations accordingly.

Using the given transition rates, we can define the following reactions:

Rabbit birth: X1 → X1+1, rate = bx1

Wolf death: X2 → X2-1, rate = dx2

Rabbit eaten and wolf birth: X1,X2 → X1-1,X2+1, rate = qx1x2

Starting with initial populations of 1000 wolves and 1000 rabbits, we can simulate the system over time and plot the results. For the phase plot where the wolf population dies out, we can set b = 0.05, d = 0.005, and q = 0.0005. For the phase plot where the rabbit population dies out, we can set b = 0.02, d = 0.01, and q = 0.001.

Finally, for the phase plot where the populations move up and down together, we can set b = 0.04, d = 0.02, and q = 0.0005. Simulating the system using the Gillespie algorithm and plotting the results, we can observe the different phase plots.

For the plot where the wolf population dies out, the rabbit population initially increases but then decreases over time. For the plot where the rabbit population dies out, the rabbit population initially increases but then quickly dies out, while the wolf population initially decreases but then increases due to the lack of rabbits to eat.

For the plot where the populations move up and down together, the populations exhibit cyclical behavior, with the wolf population lagging behind the rabbit population.

Overall, simulating the continuous time Markov chain for the dynamics of the wolf and rabbit population using the Gillespie algorithm allows us to gain insight into the behavior of the system and how the populations interact with each other.

For more details about continuous click here:

https://brainly.com/question/24898810#

#SPJ11

PLSSSS HELP IF YOU TURLY KNOW THISSS

PLSSSS HELP IF YOU TURLY KNOW THISSS

Answers

A. All of the above.

\(\huge{\color{pink}{\underline{\color{pink}{\underline{\color{cyan}{\textbf{\textsf{\colorbox{purple}{Answer ≈}}}}}}}}}\)

A. All of the above

Explanation:

This happens for the following reasons :-

Hydrogen bonds are again the key.

The number of bonds between molecules determines whether water will be a solid, liquid, or gas.

In the solid state, water molecules have the maximum number of hydrogen bonds (4 per molecule), giving water the rigid characteristic of ice.

Hope it helps you :)

Which type of asexual reproduction allows an organism to grow from an older organism? *
Which type of asexual reproduction allows an organism to grow a stem or root? *

Answers

Answer:

1.Budding 2.I do not know

Explanation:

Need help with this

Need help with this

Answers

Answer:

her arms are puffy , red and swollen

Explanation:

that is literally a sign :/

on average, 90% of energy is transferred from one trophic level to the next. group startstrue or falsetrue, g

Answers

Only 10% of the energy is transferred to the next level at each rung of the food chain, with the remaining 90% being lost as heat.

Why do trophic levels lose 90 percent of their energy? What happens to all this energy?

Energy is lost as metabolic heat when animals from one trophic level are ingested by species from the next level, hence energy diminishes as it goes up the food chain.

The remaining 90% is utilised for survival, growth, and reproduction and is wasted as heat to the environment. The base of every energy pyramid is the Sun, from which energy is transported to the first trophic level of producers. Species that devour other organisms, or consumers, receive their energy from producers.

Learn more about trophic level refer

https://brainly.com/question/1236573

#SPJ4

What are the 3 main greenhouse gases ?

Answers

Answer:

carbon dioxide

methane

nitrous oxide

Answer:

Carbon Dioxide.

Methane.

Nitrous Oxide

BRAINIEST IF CORRECT What is the ER most like in the cell

A) A factory because it makes proteins

B) A gate because it lets things in and out of the cell

C) The brain because it has the instructions and the genetic material

D) A highway with trucks because it transports molecules

Answers

Answer:

D) A highway with trucks because it transports molecules

Explanation:

Molecules, such as proteins, are transported from the ER in small sacs called transport vesicles to their proper destinations, much like on an intracellular highway.

What is the immune system response to malaria?



Outline the 3 lines of defence of the immune system.

Answers

Answer:

Although the evidence for a protective role of B cells and antibodies has been noted, the direct contribution of CD4+ T cells in protection against blood stages beyond a helper function for CD4+ T cells has mainly derived from rodent models of malaria.

Define probability. Apply the term to a coin toss.

Answers

When flipping a coin, the likelihood of getting a tail is equal to the likelihood of getting a head, or 50%, hence the probability of receiving a tail is P(Tail) = P(T) = 1/2.

What is the probability to toss a coin?

The likelihood of getting a head on a coin toss is P(Head) = P(H) = 1/2. There are just two outcomes that can occur when you toss a coin: a head (H) or a tail (T) (L). There is always a 50% chance of getting either head or tail when we flip a coin.

The probability to toss two coins having heads on both coins is 1/4 and there will be 16 outcomes if tossing 4 coins.

Therefore, if a coin is tossed, the probability might be either "head" (H) or "tail" (T). It is impossible to anticipate whether a coin toss will result in a "head" or "tail."

Learn more about probability, here:

https://brainly.com/question/14982113

#SPJ6

Dendrotoxins, produced by the mamba snakes (Dendroaspis), are inhibitors of the voltage-gated K channels. What phase of the action potential would this toxin affect

Answers

he dendrotoxins produced by the mamba snakes (Dendroaspis) affect the repolarization phase of the action potential. Dendrotoxins are peptides that are isolated from the venom of mamba snakes. These toxins are potent blockers of voltage-gated potassium channels.

Voltage-gated potassium channels are responsible for the repolarization phase of the action potential. They allow the flow of potassium ions out of the cell, thereby returning the membrane potential to its resting state. In the presence of dendrotoxins, the potassium channels are blocked, and the flow of potassium ions is reduced.

This causes the repolarization phase to be delayed or prevented altogether, leading to prolonged depolarization and a prolonged action potential. This can result in a variety of symptoms, including muscle paralysis, respiratory failure, and even death.

To know more about potential, visit:

https://brainly.com/question/28300184

#SPJ11

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Answers

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

Is
tillage a good strategy to control the weeds present in the fields?
(explain in detail rationale)

Answers

Yes the rotation is a cycle

How many chromosomes does the human genome contain?.

Answers

Forty six chromosomes

see the file attached!o(〃^▽^〃)o

How many chromosomes does the human genome contain?.

Which of the following is not a manner in which any epithelial tissues or glands are classified?a) number of cell layersb) locationc) where secretions are releasedd) shape of the cells.

Answers

The answer is c) where secretions are released. Epithelial tissues and glands are primarily classified based on the number of cell layers, shape of the cells, and location.

The number of cell layers can be either simple (single layer) or stratified (multiple layers). The shape of the cells can be squamous (flat and scale-like), cuboidal (cube-shaped), or columnar (tall and narrow).

The location can be either surface epithelia (lining body surfaces or cavities), glandular epithelia (forming glands), or transitional epithelia (lining organs that stretch and contract like the bladder). Secretion is an important function of glandular epithelia, but it is not a classification criteria for epithelial tissues and glands.

Therefore, the answer is c) where secretions are released.

Learn more about secretions here:

brainly.com/question/7814197

#SPJ11

populations change over time by the process of select answer , which proceeds by the major mechanism of select answer

Answers

populations change over time by the process of Evolution , which proceeds by the major mechanism of natural selection

Evolution is phenomena of population in which the heritable characteristics of the organisms are changed over time through successive generation.

Evolution occurs because the environment is continuously changing and the organisms have to adapt themselves in the condition for survival.

One of the major process by which evolution occurs is natural selection. It is process in which the individual who are more adapted to the environment will be only selected by the nature and will be able to produce offsprings.

Other than natural selection, evolution can occur by genetic drift, mutation, etc.

To learn more about evolution here

https://brainly.com/question/13492988

#SPJ4

Arrange the rock layers from oldest to youngest. Reexamine the rock outcrops if you need to. Record the order in the Student guide.
Basalt
Limestone with unknown fossil
Sandstone with trilobite
Shale with ammonite

Arrange the rock layers from oldest to youngest. Reexamine the rock outcrops if you need to. Record the

Answers

It should be sand stone then shale then lime stone and then basalt. This is cause the sand and trilobites were at the bottom of the ocean the shale and ammonite were above them but not above lime. Basalt is last because it’s caused by lava or hot matter cooling quickly in water so lime has to be below basalt yet above sand and shale. The fossil in lime wouldn’t be below trilobites or ammonites because they were some of the first.

Based on the provided information, the rock layers can be arranged from oldest to youngest as follows: shale with ammonite (oldest), Limestone with unknown fossils, Sandstone with trilobite, and basalt (youngest).

This arrangement is based on the principle of superposition, which states that in an undisturbed sequence of sedimentary rocks, the oldest rocks are found at the bottom and the youngest rocks are found at the top. Since the shale with ammonite is mentioned first and the basalt is mentioned last, we can infer that the shale layer is the oldest and the basalt layer is the youngest among the given options.

Learn more about the rock layer here.

https://brainly.com/question/28167675

#SPJ2

in a(n) ________ synapse, there is a direct physical connection between cells.

Answers

In an electrical synapse, there is a direct physical connection between cells. Electrical synapses, also known as gap junctions, allow for the direct transfer of electrical signals between cells.

This type of synapse is less common than chemical synapses, which rely on the release of neurotransmitters to communicate between cells. However, electrical synapses are important in certain areas of the nervous system, such as the heart and some regions of the brain, where rapid communication is necessary for coordinated activity. At electrical synapses, the gap junctions allow for ions to flow between cells, allowing for the direct spread of electrical signals without the need for neurotransmitter release and binding.
In an electrical synapse, there is a direct physical connection between cells. Electrical synapses allow rapid communication between neurons through gap junctions, which are specialized structures that facilitate the flow of ions and electrical signals between adjacent cells. This direct connection ensures faster signal transmission compared to chemical synapses, where neurotransmitters are involved in passing the signal between neurons. Electrical synapses play a crucial role in coordinating the activity of large groups of neurons, allowing for synchronized responses and quick reactions.

For more information on neurotransmitters visit:

brainly.com/question/9725469

#SPJ11

Which statement best explains the overall function of Molecule 2
in the diagram?
O It serves as short term storage for energy.
O It supplies sugars to be broken down for energy.
O It contains the instructions for building proteins.
O It translates instructions to build proteins.

Which statement best explains the overall function of Molecule 2in the diagram?O It serves as short term

Answers

Answer: I’m not sure but it might be the third one.

Explanation:

Answer:

3. It contains the instructions for building proteins.

Explanation:

what is the main difference between a biome and an ecosystem ecosystems are typically bigger

Answers

The main difference between a biome and an ecosystem is that biomes are large-scale geographic regions with similar climate and vegetation, while ecosystems are smaller and encompass specific interactions between organisms and their environment.

A biome is a broad geographic area characterized by similar climatic conditions, vegetation types, and animal communities. Examples of biomes include tundra, desert, tropical rainforest, and grassland. Biomes are defined by their unique combination of temperature, precipitation, and dominant plant species. They cover large regions and can span multiple continents. Within a biome, you can find various ecosystems.

On the other hand, an ecosystem is a smaller-scale unit that encompasses a specific community of organisms interacting with each other and their physical environment. It includes living organisms (biotic factors) and their non-living surroundings (abiotic factors), such as soil, water, sunlight, and temperature. Ecosystems can be as small as a pond or as large as a forest. They are dynamic and interconnected systems where energy flows and nutrients cycle among organisms.

While biomes provide a broader classification based on climate and dominant vegetation, ecosystems focus on the relationships and interactions between organisms within a specific geographical area. Ecosystems can exist within different biomes, each with its own unique characteristics and species compositions.

Learn more about  Biome and an Ecosystem

brainly.com/question/31092061

#SPJ11

Do you think that humans have a responsibility to monitor how they influence the biosphere?

Answers

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

in a galvanic cell, the reduction happens at the ____ and the oxidation happens at the _____ .

Answers

In a galvanic cell, the reduction happens at the cathode and the oxidation happens at the anode.

A galvanic cell, also known as a voltaic cell, is a device that generates electrical energy through spontaneous redox reactions. It consists of two electrodes (cathode and anode) connected by an external wire and an electrolyte solution that allows the flow of ions.

Process in a galvanic cell:

1. Oxidation occurs at the anode: At the anode, a chemical species loses electrons, resulting in an increase in its oxidation state. The lost electrons flow through the external wire towards the cathode.

2. Reduction occurs at the cathode: At the cathode, a different chemical species gains the electrons that have traveled through the external wire, resulting in a decrease in its oxidation state.

3. Ion flow in the electrolyte: To maintain charge neutrality, ions from the electrolyte solution will flow between the two electrodes. This flow of ions allows the reaction to continue, as it balances the charges created by the transfer of electrons.

4. Electrical energy production: The flow of electrons from the anode to the cathode through the external wire generates an electrical current, which can be used to power various devices.

In summary, in a galvanic cell, the reduction reaction takes place at the cathode, while the oxidation reaction occurs at the anode. These reactions produce electrical energy by transferring electrons between the two electrodes through an external wire.

To know more about galvanic cell:

https://brainly.com/question/25606438

#SPJ11

explain the role of dna in passing down LCA from parents to offspring

Answers

The role of DNA in passing down LCA from parents to offspring is to carry the genetic information that causes the disorder from one generation to the next.

Leber congenital amaurosis (LCA) is a rare inherited eye disorder that results in progressive vision loss and blindness in infants and young children. LCA is caused by mutations in genes that are important for the function of the retina, the part of the eye that detects light and transmits visual signals to the brain.

DNA plays a crucial role in passing down the genetic information that causes LCA from parents to their offspring. DNA is composed of sequences of four chemical building blocks or nucleotides, and the order of these nucleotides determines the genetic information contained in the DNA molecule.

When a person with LCA has a child, they pass on a copy of their DNA to their offspring. If the child inherits a mutated version of the gene that causes LCA, they will develop the disorder. The inheritance pattern of LCA depends on the specific type of gene mutation and can be passed down in different ways, including autosomal recessive inheritance, in which the child inherits two copies of the mutated gene, one from each parent.

Know more about LCA here: https://brainly.com/question/23633395

#SPJ4

.

This central organelle in plant cells helps to keep the plant cell turgid:

Answers

Answer:

The central vacuole

Answer:

The large central vacuole.

Explanation:

specialized lymphatic capillaries called lacteals are specialized lymphatic capillaries called lacteals are located primarily in the large intestine. more numerous than blood capillaries. located throughout the body. part of the fenestrated capillary group. necessary for the transport of dietary lipids.

Answers

Specialized lymphatic capillaries called lacteals are located primarily in the small intestine. These lymphatic capillaries called lacteals are necessary for the transport of dietary lipids. Lacteals are located in the villi and are a part of the lymphatic system. These lymphatic capillaries called lacteals are necessary for the transport of dietary lipids.

They are more numerous than blood capillaries. The digestion of lipids takes place in the small intestine with the help of bile secreted by the liver and stored in the gallbladder. These fats are broken down into tiny particles called micelles, which can be absorbed by the intestinal walls. After the lipids have been absorbed, they enter the lacteals, which then transport them to the lymphatic system. This is because dietary lipids are not water-soluble, which means they cannot be transported by blood. The lymphatic system is responsible for the transportation of large molecules that cannot be transported by blood, such as lipids. The lacteals are located in the villi of the small intestine, which are finger-like projections that line the small intestine. They are specialized lymphatic capillaries that are responsible for the transportation of dietary lipids. These lacteals are more numerous than blood capillaries, which highlights the importance of their function.

for more such question on lacteals

https://brainly.com/question/14087659

#SPJ11

there is a great deal of evidence for evolution, but ____ definitely tell us the most about the history of life of earth

Answers

history

Explanation:

I mean it's not rocket science

Most sex-linked genes are located on:

- The X chromosome only
- The Y chromosome only
- Both the X chromosome and the Y chromosome

Answers

Answer:

X chromosome has more sex-linked genes than the Y chromosome

chooe the name of the tract that might be damaged when the following condition are oberved

Answers

A descending spinal tract called the lateral corticospinal tract transmits voluntary motor impulses from the brain to the body's extremities damaged.

A spinal cord damage would prevent voluntary movement above and below the injured level. To accommodate the more nerve cells and connections required to process information relevant to the upper and lower limbs, two areas of the spinal cord are expanded (see Figure 1.10B). The ventral horn is spherical, whereas the dorsal horn is thin and reaches to the spinal cord's border. Reduced postural control and impaired selectivity of postural control can be caused by lesions to the cortico-reticulospinal system.

Learn more about damaged

https://brainly.com/question/8305258

#SPJ4

Fertilizer grade is the relative _________ in a bag of fertilizer.

Proportion

Percentage

Grade

Ratio​

Answers

Answer:

proportionhejenrn4nrrh4htj

I NEED HELP WITH BOTH OF THESE
PLEASE HURRY

I NEED HELP WITH BOTH OF THESE PLEASE HURRY
I NEED HELP WITH BOTH OF THESE PLEASE HURRY

Answers

Answer:

18. Which four body systems interact to allow a person to sneeze:

F. Muscular, immune, nervous, respiratory.

Don't really know the answer for the second one, sorry <33

Other Questions
Which insect is an important of blueberries and cranberries in New JerseyStink bugsSpotted lantern flySpotted wing drosophilaGreen aphid [tex] \frac{ \times + 6}{7} = 1[/tex]find the missing term Kai has begun to list, in ascending order, the positive integers which are not factors of 240.What is the sixth number on Kais list? a rise in demand is represented by a leftward shift in the demand curve, and a fall in demand is represented by a rightward shift in the demand curve. Explain where energy goes once it is used. Prove that a+b/2ab Teresa babysits for her neighbors. She charges $13 for the first hour and $10 for each additional hour. Write a rule for the total amount of money she charges, T, based on the number of hours she babysits, H. Angela also babysits for her neighbors. She charges $11 per hour. Which babysitter, Teresa or Angela, will charge less to babysit for 2 hours? 3 hours? 4 hours? Show evidence for your answers. what percent of 50 is 8 FILL THE BLANK. the _____ factor refers to a persons individual life events. According to the social style matrix, individuals classified as "drivers" have a great desire to get ahead in their companies and careers. true or false You are given a long text to read to customers who sign up for a medical service. this text makes your calls go on for longer which can upset customers. a child has been prescribed desmopressin acetate for the treatment of diabetes insipidus. the client and the parents ask the nurse how this drug works. what is the correct response by the nurse? The control badge measures background exposure during the1. Transportation of badges2. Handling of badges3. Storage of badgesA1 onlyB1 and 2 onlyC1 and 3 onlyD1, 2, and 3 Bonjour qui peut m'aider c'est rapide s'il vous plat What is the wavelength of a radar signal that has a frequency of 33 GHz? What is an equation that represents the linear function described by the data in Item 5? You are given the equation below. Not yet saved Marked out of 1.00 PV = C/i (1-(1/ (1+1^10)(1+i). Which of the following statements is FALSE? Select one: A. The equation will indicate the present value of an annuity of 10 payments, where the first payment is made at the beginning of the first period. B. The equation will indicate the present value of an annuity of 10 payments, where the first payment is made at the end of the first period. C. The equation will indicate the present value of an annuity of 10 payments, where the first payment is made now. D. The equation is suitable to calculate the present value of an annuity due. tensile testing is not appropriate for hard brittle materials such as ceramics. what is the test commonly used to determine the strength properties of such materials? why there is scatter in the measured strength data for ceramics? Which equation does this picture BEST represent? A. 49 7 = 7 B. 49 - 7 = 42 C. 7 - 7 = 0 D. 49 - 49 = 0 if cola and iced tea are good substitutes for consumers, then it is likely that: group of answer choices rise in price of one leads to rise in demand for other. their price elasticities of demand are less than one. their price elasticities of supply are less than one. their income elasticities are less than zero.