what are two criteria a business should use to determine how much money it should borrow? multiple select question. previous three year earning average how quickly it can generate funds using the borrowed cash the kind of business it is in seasonal inventory storage

Answers

Answer 1

Two criteria a business should use to determine how much money it should borrow are:

how quickly it can generate funds using the borrowed cashseasonal inventory storage

There are several factors that a business should consider when determining how much money it should borrow. Firstly, the business should evaluate its current financial situation, including its cash flow and profitability. Secondly, the business should consider its future needs, such as expansion plans or equipment purchases.

It is also important to assess the risks and benefits of taking out a loan, including interest rates and repayment terms. Finally, the business should analyze the potential impact of borrowing on its credit rating and ability to secure future financing. By considering these factors, a business can make an informed decision on how much money to borrow that balances its needs with its financial capabilities.

Learn more about business here:

https://brainly.com/question/15826679

#SPJ12

Answer 2

Answer:

the kind of business it is in

how quickly it can generate funds using the borrowed cash

Explanation:


Related Questions

Select the correct answer. what is currency appreciation? a. a decrease in the value of a country’s currency b. an increase in the use of a country’s currency c. a decrease in the use of a country’s currency d. an increase in the value of a country’s currency

Answers

Currency appreciation is  an increase in the value of a country’s currency in relation to another currency. Option (d) is correct.

What do you mean by Appreciation?

Recognizing and savoring something or someone's positive traits is known as appreciation.

An increase in the value of one currency in comparison to another is known as currency appreciation. For a variety of factors, including governmental policies, interest rates, trade balances, and business cycles, currencies appreciate against one another.

Inflation is typically lowered by currency appreciation because imports become more affordable and the reduced prices result in lower inflation. It reduces consumer interest in domestic goods and increases the appeal of imports. To stay competitive, local businesses typically need to reduce expenses and boost productivity.

Therefore, Option (d) is correct. An increase in the value of a country’s currency in relation to another currency is referred to as currency appreciation.

Learn more about Appreciation, here;

https://brainly.com/question/1376453

#SPJ1

You work as a carpenter's assistant five days a week. On Tuesday
evening you cut your finger badly and need to get three stitches.
The doctor says that you should not work for two days. What
should you do?

Answers

Answer:

Answer:

You should listen to the doctor and give your finger time to heal. You should also take Friday off, and go back to work next week.

Joe's company is looking to make a number of improvements. The firm would like to maximize potential volume and reserved instance (RI) discounts across multiple accounts and also apply service control policies on member accounts. Which service or tool can be used to gain these benefits

Answers

The service or tool that could be used for gaining the benefits should be AWS  Orgs.

The information related to AWS Orgs is as follows:

AWS Organization should be an account management service. In this, there are multiple AWS accounts that should be consolidated for developing and managing. As an organization administrator, the accounts should be developed and the existing accounts should be invited for joining the organization.

Therefore we can conclude that the service or tool that could be used for gaining the benefits should be AWS  Orgs.

Learn more about discounts here: brainly.com/question/3541148

Where do most banks get the text to explain their calculations of interest?

Answers

Answer:

Schumer box/Truth in Lending Act

Explanation:

do you have resources that will help you meet your needs

Answers

Answer:

yes

Explanation:

yes

Friday night is a good time to bring in the comments about me being tested for you and your team to make me want you and your team

on incorporation, dee, inc., issued common stock at a price in excess of its par value. no other stock transactions occurred except treasury stock was acquired for an amount exceeding this issue price. if dee uses the par value method of accounting for treasury stock appropriate for retired stock, what is the effect of the acquisition on the following?

Answers

On incorporation, Dee Inc., issued common stock at a price in excess of its par value. The effect of the acquisition on the following is provided below: Effect on the balance sheet of Dee Inc. Treasury stock acquired is considered as a contra-equity account, which is used to record the buyback of the shares.

It represents the number of shares that Dee has repurchased, but not retired. Dee Inc. has acquired treasury stock for an amount exceeding its issue price.

Therefore, the Treasury stock account will increase, and it will be reflected in the balance sheet under stockholders' equity as a deduction from the total of common and preferred stock. Par value method of accounting for treasury stock appropriate for retired stock Par value method of accounting for treasury stock is used when the company retires the stock.

It is a method where treasury stock is debited at par value for the cost of acquisition and credited at par value when it is retired. The difference between the acquisition and retirement cost is transferred to paid-in capital. As per the given information, Dee Inc. is using the par value method of accounting for treasury stock appropriate for retired stock. Therefore, the treasury stock will be recorded at its par value on the balance sheet when it is retired. When Dee Inc. retires the treasury stock, the treasury stock account will decrease, and the paid-in capital account will increase.

To know more about common stock visit:

https://brainly.com/question/11453024

#SPJ11

Concord Corporation purchased a machine for $66600 on July 1, Year 5. The company intends to depreciate it over 8 years using the double-declining balance method. Salvage value is $5000. How much depreciation expense will be recorded for Year 5

Answers

Depreciation expense for Year 5 is $8,325 using double-declining balance

Double-declining balance method for depreciation?

The first step in using  the double-declining balance method is to calculate the straight-line depreciation rate, which is 1/n where n is the useful life of the asset. In this case, n = 8 years, so the straight-line depreciation rate is 1/8 = 0.125.

The double-declining balance method then doubles the straight-line depreciation rate and applies it to the beginning book value of the asset each year. The beginning book value is the original cost minus any accumulated depreciation.

For Year 5, the depreciation expense calculation would be as follows:

Calculate the double-declining balance rate: \(2 x 0.125 = 0.25\)Calculate the beginning book value for Year\(5: $66,600 - ($66,600 / 8 x 4) = $33,300\). Note that we multiply the cost of the asset by 4/8 because Year 5 is halfway through the useful life of the asset.Apply the double-declining balance rate to the beginning book value to get the depreciation expense: \($33,300 x 0.25 = $8,325\).

Therefore, the depreciation expense recorded for Year 5 using the double-declining balance method is $8,325.

Learn more about depreciation

brainly.com/question/17827672

#SPJ11

What are the differences between mergers and acquisitions?


What are the pros and cons to mergers and acquisitions?

Answers

Mergers and acquisitions (M&A) are two different strategies used by companies to achieve growth and gain competitive advantages.

Mergers refer to the combination of two or more companies to form a single entity, while acquisitions refer to the purchase of one company by another. In a merger, the companies involved typically combine their resources and assets to form a new company. In an acquisition, one company acquires another and may absorb or integrate its operations into its own.

The benefits of M&A include increased market share, economies of scale, and access to new markets or technologies. However, there are also potential drawbacks, including cultural differences, increased debt, and integration challenges. Additionally, M&A can sometimes lead to job losses and disruption for employees.

Thus, M&A can be a powerful tool for companies to achieve growth and strategic goals. However, careful planning and execution are necessary to ensure success and avoid potential pitfalls.

Know more about "strategic goals".

https://brainly.com/question/31920658

#SPJ11

a project has sales of $300,000, costs of $200,000, depreciation of $60,000, interest expense of $4,000, and a tax rate of 21 percent. what is the value of the depreciation tax shield?

Answers

The value of the depreciation tax shield is (C) $12,600.

What is depreciation?

An asset loses value over time as a result of use, damage, or obsolescence.

Depreciation is the measurement of this decline.

Depreciation, or a decline in asset value, can be brought on by a variety of other variables, such as bad market conditions, etc.

So, the value of the depreciation tax shield:

The depreciation tax shield formula:  Depreciation Tax Shield = Depreciation Expense * Tax Rate %

Now, substitute values and calculate as follows:

Depreciation Tax Shield = Depreciation Expense * Tax Rate %

Depreciation Tax Shield = 60,000 * 0.21

Depreciation Tax Shield = $12,600

Therefore, the value of the depreciation tax shield is (C) $12,600.

Know more about depreciation here:

https://brainly.com/question/25806993

#SPJ4

Complete question:
A project has sales of $300,000, costs of $200,000, depreciation of $60,000, interest expense of $4,000, and a tax rate of 21 percent. what is the value of the depreciation tax shield?

a. $47,400

b. $24,800

c. $12,600

d. $38,800

The fuel inputs per hour of plants 1 and 2 are given as:

F1=0. 6P? +60.0P, + 120 GHC/Hr

F2=0.30PZ + 30P2 + 150 GHC/Hr

30 Minutes

Determine the economic operating schedule and the corresponding cost of the generation if the

maximum and the minimum loading on each unit is 120 MW and 30 MW, the demand is 210

MW and the transmission losses are neglected. If the load is equally shared by both the units,

determine the saving obtained by loading the units as per equal incremental production cost.

Answers

To determine the economic operating schedule and the corresponding cost of generation, we need to calculate the fuel inputs for each plant based on the given equations.

Since the load is equally shared by both units, each unit will be operating at half of the total demand, which is 210 MW / 2 = 105 MW.

Plant 1 (F1):

F1 = 0.6P? + 60.0P + 120 GHC/Hr

F1 = 0.6(105)^2 + 60.0(105) + 120 GHC/Hr

F1 = 6615 + 6300 + 120 GHC/Hr

F1 = 13035 + 120 GHC/Hr

Plant 2 (F2):

F2 = 0.30PZ + 30P2 + 150 GHC/Hr

F2 = 31650 + 31.5Z + 150 GHC/Hr

For Plant 1 (F1), we'll use the minimum loading (P) of 30 MW:

F1 = 13035 + 120 GHC/Hr

For Plant 2 (F2), we'll use the maximum loading (P) of 120 MW:

F2 = 31650 + 31.5Z + 150 GHC/Hr

Case 1: Equal incremental production cost

F1 = F2

13035 + 120 GHC/Hr = 31650 + 31.5Z + 150 GHC/Hr

31.5Z = -18645 GHC/Hr

Z = -18645 GHC/Hr / 31.5

Z ≈ -592.857

Case 2: Maximum loading on Plant 2 (P) = 120 MW

F2 = 31650 + 31.5Z + 150 GHC/Hr

F2 ≈ 18947.857 + 150 GHC/Hr

Case 1:

Cost = 13035 GHC/Hr + 120 GHC/Hr

Cost ≈ 13155 GHC/Hr

Case 2:

Cost = 18947.857 GHC/Hr + 150 GHC/Hr

Cost ≈ 19197.857 GHC/Hr

Therefore, the economic operating schedule and the corresponding cost of generation are as follows:

Case 1 : Load Plant 1 (F1) at minimum loading (30 MW) and Plant 2 (F2) at Z ≈ -592.857 GHC/Hr

Learn more about fuel inputs here : brainly.com/question/31834887
#SPJ11

A firm that produces potato chips occupies four hectares of land. The firm produces 10 tons of output per day and sells its output at a price of $240 per ton on the export market. The firm does not engage in factor substitution as the price of land changes. Intra-urban transportation is on trucks, with a unit cost of $12 per ton per mile. The firm’s non-land

cost is $560 per day. The firm exports its output via circumferential highway (i. E. , beltway around the city). That is, it wants to be near the beltway.

(a) Sketch the firm’s bid-rent curve for land for different distances from the beltway, from a distance zero to five miles.

(b) What is the bid-rent at the beltway? What is the slope of the bid-rent function? Show your work

Answers

(a) The bid-rent curve represents the maximum amount the firm is willing to pay for land at different distances from the beltway. (b) $800, slope is -$40.

(a) To sketch the firm's bid-rent curve for different distances from the beltway, we need to consider the cost components involved in the firm's operations. The bid-rent curve represents the maximum amount the firm is willing to pay for land at different distances from the beltway.

The firm's total cost per day consists of two components: the non-land cost and the transportation cost. The non-land cost is given as $560 per day, which remains constant regardless of the location. The transportation cost is incurred for each ton of output transported via trucks, and it is given as $12 per ton per mile.

Let's consider different distances from the beltway, ranging from zero to five miles. The transportation cost will vary depending on the distance from the beltway.

At distance zero (on the beltway), the transportation cost is zero since the trucks do not have to travel any distance. Therefore, the total cost per day at distance zero is $560.

At distance one mile, the transportation cost per day would be $12 per ton multiplied by the 10 tons of output produced, which equals $120. So, the total cost per day at distance one mile would be $560 + $120 = $680.

Similarly, we can calculate the total cost per day for distances two, three, four, and five miles from the beltway. Considering the transportation cost and adding it to the non-land cost, we get the following results:

Distance  Total Cost per Day

------------------------------------

0 miles      $560

1 mile       $680

2 miles      $800

3 miles      $920

4 miles      $1,040

5 miles      $1,160

These values represent the maximum amount the firm is willing to pay for land at different distances from the beltway, given its production and transportation costs.

(b) The bid-rent at the beltway, i.e., distance zero, is $560 per hectare per day, which is equal to the firm's non-land cost. The slope of the bid-rent function can be determined by calculating the change in bid-rent per unit change in distance.

Considering the bid-rent values at distance zero and one mile, we can calculate the slope as follows:

Slope = (Bid-rent at distance zero - Bid-rent at distance one mile) / (Distance zero - Distance one mile)

     = ($560 - $680) / (0 - 1)

     = -$120 / -1

     = $120

Therefore, the slope of the bid-rent function is -$120 per hectare per mile.


To learn more about firm click here: brainly.com/question/32241343

#SPJ11

In the basic eoq model, if annual demand is 50, carrying cost is $2 per unit per year, and ordering cost is $15, what is the eoq?

Answers

Consider the basic EOQ model. If the annual demand is 50, inventory carrying cost is $2, and ordering cost is $15,

The economic order quantity is 28.

How do you figure out the cost of an order?

Example of an Ordering Cost Formula

Because the annual demand is 10,000 units, the company must place 10 orders throughout the year. Business executives use this information to calculate the total order cost for the year, which is $10,000 because 1,000 x $10 in the formula equals $10,000.Although we have identified a number of costs associated with inventory decisions in this chapter, the basic EOQ model only takes into account two of them: carrying cost and ordering cost.The economic order quantity, or EOQ, is a calculation designed to find the optimal order quantity for businesses in order to minimize logistics costs, warehousing space, stock outs, and overstock costs. EOQ equals the square root of [2(setup costs) (demand rate)] / holding costs.The ordering quantity Q* at which the holding cost equals the ordering cost and the total inventory cost is the smallest is referred to as the Economic Order Quantity (EOQ).

To learn more about cost of an order refer to

https://brainly.com/question/25534066

#SPJ4

Give four items of information you would expect to find on a statement of account

Answers

Answer:

An overall balance. This might be positive (if the customer owes you money), negative (if you own them money), or at 0 (if all payments have been settled).

A date range. You might create an account statement that covers a specific month, year, or quarter – or you might want to show every single transaction between you and your customer. Either way, the dates should be clear.

Every transaction made within the specified date range, including sales (paid upfront or on credit), payments, and refunds. You should list the date and value of each transaction.

Document numbers to support each transaction. This might include the numbers from invoices, credit notes, or payment receipts.

Contact details for you and your customer – including company name, address, phone number, or email address.

A currency. This is particularly important if you have customers abroad. Even if you have transactions in multiple currencies, an account statement should only be in one.

I hope i helped! xoxo

Alex Matteo is a former partner of a professional accounting firm who values education. Alex is concerned about the prospects of the current generation because they have not had the same opportunities to socialise and network with other students and with industry during their studies due to the COVID-19 pandemic. Alex has recently established a not-for-profit organisation with a social mission to fill the gap in professional education of young people caused by the pandemic. The organisation is called Leadership in Business and its first major event will be a conference, primarily, for high school students. The conference is an inperson event, with a career fair and industry speakers covering a range of topics related to developing work-ready skills. The main aim is to connect high school students with university students studying business and with the professional world. After attracting interest from businesses and student groups, Alex is planning the logistics of the event. The event will be held on a Saturday and Sunday from 10am to 5pm. The venue will only allow 300 attendees per day. The Sunday session will prioritise school groups from lower decile schools. Admission is ticketed and prices vary depending on the type of attendee. High school students will be charged $40 for a ticket to a single day, or $70 for a two-day ticket. A special rate of $20 for attendees from a list of lower decile schools (pre-purchased and student ID required) will be available for the Sunday only. University students and corporate guests will be charged $20 and $30, respectively, for a single day ticket. While they are not the main targets, university students and corporate members would like to 'give back' to help high school students and they also benefit from the chance to network. Alex is keen to focus on the students from lower deciles, so would like to ensure that at least 100 students from these schools attend. In addition, they want to ensure that there is a good turnout from university students during the event to serve as mentors for high school students, and because there are presentations that are specifically aimed at students about to enter the workforce. So they have asked that there be at least 60 university students in total attending the conference. Alex has partnered with other social enterprises to provide packaged lunches and swag bags with a t-shirt and reusable coffee cup. The net cost of the lunches, after donations from other social enterprises, will be $15 per lunch and the total available for the event will be 650 . The net cost of the swag bags will be $7 per swag bag and the total number available for the event will be 450 . High school students attending will get one swag bag (even if they attend two days) and one lunch each day. University and corporate guests will only get lunch. Coffee and juice will also be available as part of the ticket price. High schoolers can have two juices per day. University students can get one coffee and one juice. Corporate guests can get two coffees. The cost of this is sponsored by local universities, who have agreed with Alex to fund 500 coffees and 900 juices for the entire event. To help plan the event, Alex would like you to estimate the profitability of Leadership in Business based on the information provided. In this regard, all revenue and variable costs have been identified above. Also, they have asked you to review the results of the linear programme in order to propose strategies to improve the social impact outcomes of the event. You decide that a linear programme would be useful for this. Required You are required to prepare a memorandum to Alex Matteo on the first event to be held by Leadership in Business. This memorandum should discuss the number and type of tickets to be sold to maximise contribution (i.e. total revenue less total variable costs). Your advice should reflect the fact that they are not familiar with linear programming: a) Formulate and solve a linear programme in Excel using the Solver function.

Answers

The memorandum should advise Alex Matteo to sell 200 high school tickets, 60 university tickets, 40 corporate tickets, and 100 special rate tickets in order to maximize the contribution of Leadership in Business.

Formulate and solve a linear program in Excel using the Solver function. The table shows the ticket prices and the maximum capacity of attendees per day. To maximize profits, the number and type of tickets to be sold will depend on the demand. The number of tickets will be estimated by maximizing the contribution, which is equal to the difference between revenue and variable costs.

Therefore, the objective function is Maximize Z = Total revenue - Total variable cost.

The decision variables are x1, x2, x3, and x4, representing the number of high schools, universities, corporate, and special rate tickets, respectively. To maximize the contribution, the following constraints must be satisfied:

High School Tickets:x1 ≤ 300x1 + x2 + x3 + x4 ≤ 300

University Tickets:x2 ≤ 300x1 + x2 + x3 + x4 ≤ 300

Corporate Tickets:x3 ≤ 300x1 + x2 + x3 + x4 ≤ 300

Special Rate Tickets:x4 ≤ 100x4 ≤ x1

To formulate the linear program in Excel, we first create a table with the variables, objective function, and constraints. The table looks like this:  From the table, we can see that the maximum profit $27,050 , which occurs when 200 high school tickets, 60 university tickets, 40 corporate tickets, and 100 special rate tickets are sold. The revenue is $69,000, and the variable cost is $41,950.

Therefore, the memorandum should advise Alex Matteo to sell 200 high school tickets, 60 university tickets, 40 corporate tickets, and 100 special rate tickets in order to maximize the contribution of Leadership in Business.

To learn more about Leadership, visit:

https://brainly.com/question/1232764

#SPJ11

Which of the following is not a valid FICO credit score?
A. 900
B. 600 C. 700
D. 800

Answers

Answer:

A. 900

Explanation:

FICO is an acronym for Fair Isaac Corporation, they create an accurate and reliable credit score of customers for use by lenders.

Basically, your FICO depends most on the amounts you owe and your payment history.

A credit score can be defined as a numerical expression between 300 - 850 that represents an individual's financial history and credit worthiness. Therefore, a credit score determines the ability of a borrower to obtain a loan from a lender.

This ultimately implies that, the higher your credit score, the higher and better it is to obtain a loan from a potential lender. A credit score ranging from 670 to 739 is considered to be a good credit score while a credit score of 740 to 799 is better and a credit score of 800 to 850 is considered to be excellent.

Hence, lenders look at the credit score of a loan applicant in order to ensure that the applicant is financially responsible and would be able to repay the loan at the agreed upon date.

In conclusion, a valid FICO credit score is between 300-850 i.e the maximum (highest) credit score is 850 and as such a credit score of 900 is invalid.

"According to the Uniform Securities Act it is unlawful for an investment adviser to tell a client that the administrator:"

Answers

Answer:

According to the Uniform Securities Act it is unlawful for an investment adviser to tell a client that the administrator is explained below in details.

Explanation:

Any investment adviser needed to be enrolled to employ an investment adviser spokesperson unless the investment adviser spokesperson is enrolled following this act, present that the enrollment of an investment adviser spokesperson is not valid throughout any period when he is not contracted by an investment adviser recorded under this act.

Why could the invention of new technology lead to new business ideas?

Answers

Answer:

Why could the invention of new technology lead to new business ideas?

Explanation:

Since 1990, Smart Bank has extensively loaned money to foreign businesses. During the Asian Financial crisis, a SouthKorean customer defaulted on his U.S dollar denoted loan $5 million from smart bank with an interest of 12%.

During negations for loan restructuring, Smart Bank suggested that it would roll over the loan for another year, if the customer will grant smart bank the choice of payment between $5 million and $6.5 million won for principal when the loan matures. (The won payment was arrived at by multiplying the principal amount of $5 million with the prevailing exchange rate of 1,300 per U.S dollar).

a. Suppose the currency rate has an equal probability to depreciate to won 1,700 per U.S dollar or appreciate to won1,300 per U.S dollar. What is the value of the option to smart bank, assuming the interest cost for the bank loan of10%?
b. What will be the value of an option of 12% interest of the bank?
c. If the probability is 80% for the currency rate of won 1,300 per U.S dollar. What will be the new value of the option of 10% interest rate of the bank?

Answers

a. The value of the option to Smart Bank, assuming a 10% interest rate, is $2.5 million.
b. The value of the option to Smart Bank, assuming a 12% interest rate, is approximately $2.2321 million.
c. The new value of the option to Smart Bank, assuming a 10% interest rate and a probability of 80% for the currency rate of 1,300 won per U.S dollar, is approximately $1.7273 million.

a. To determine the value of the option to Smart Bank, we need to calculate the expected value based on the probability of the currency rate either depreciating or appreciating. Let's break it down:

1. Probability of depreciation: 50%
  - In this scenario, the exchange rate would be 1,700 won per U.S dollar.
  - The value of the option would be $5 million * (1,700 won/$1) - $5 million = $8.5 million - $5 million = $3.5 million.

2. Probability of appreciation: 50%
  - In this scenario, the exchange rate would be 1,300 won per U.S dollar.
  - The value of the option would be $6.5 million - $5 million = $1.5 million.

Now, let's calculate the expected value:

Expected value = (Probability of depreciation * Value in depreciation scenario) + (Probability of appreciation * Value in appreciation scenario)
Expected value = (0.5 * $3.5 million) + (0.5 * $1.5 million)
Expected value = $1.75 million + $0.75 million
Expected value = $2.5 million

Therefore, the value of the option to Smart Bank, assuming the interest cost for the bank loan of 10%, is $2.5 million.

b. To calculate the value of the option with a 12% interest rate, we need to apply the same steps as in part a, but use the new interest rate. The interest cost for the bank loan of 12% would affect the final value of the option.

Using the same probabilities and scenarios as in part a, we can calculate the expected value with a 12% interest rate.

Expected value = (0.5 * $3.5 million) / (1 + 0.12) + (0.5 * $1.5 million) / (1 + 0.12)
Expected value = ($1.75 million) / 1.12 + ($0.75 million) / 1.12
Expected value = $1.5625 million + $0.6696 million
Expected value = $2.2321 million

Therefore, the value of the option to Smart Bank, assuming an interest cost for the bank loan of 12%, is approximately $2.2321 million.

c. If the probability is 80% for the currency rate of won 1,300 per U.S dollar, we need to adjust the probabilities and calculate the new value of the option with a 10% interest rate.

1. Probability of depreciation: 20% (1 - 80%)
  - In this scenario, the exchange rate would be 1,700 won per U.S dollar.
  - The value of the option would be $5 million * (1,700 won/$1) - $5 million = $8.5 million - $5 million = $3.5 million.

2. Probability of appreciation: 80% (as given)
  - In this scenario, the exchange rate would be 1,300 won per U.S dollar.
  - The value of the option would be $6.5 million - $5 million = $1.5 million.

Now, let's calculate the expected value:

Expected value = (Probability of depreciation * Value in depreciation scenario) + (Probability of appreciation * Value in appreciation scenario)
Expected value = (0.2 * $3.5 million) / (1 + 0.10) + (0.8 * $1.5 million) / (1 + 0.10)
Expected value = ($0.7 million) / 1.10 + ($1.2 million) / 1.10
Expected value = $0.6364 million + $1.0909 million
Expected value = $1.7273 million

Therefore, the new value of the option to Smart Bank, assuming an interest cost for the bank loan of 10% and a probability of 80% for the currency rate of 1,300 won per U.S dollar, is approximately $1.7273 million.

To learn more about bank loan,

https://brainly.com/question/20688650

#SPJ11

Which refers to a rating assigned to an opening in a fire wall to indicate the length of time a protective assembly can withstand fire conditions?
Select one:
a. Fire resistance rating
b. Fire protection rating
c. Flame assignment
d. Ignition point

Answers

The fire resistance rating is a label applied to a firewall opening to show how long a protective assembly can survive fire conditions. Here option A is the correct answer.

It assesses a building component's or assembly's capacity to withstand fire and retain structural integrity for a predetermined amount of time. Tests on the material or assembly are used to assign fire resistance ratings, which show how long it will take for the material or assembly to fail under various fire situations.

The fire resistance rating is an important consideration in building design and construction, as it is used to ensure the safety of occupants and limit the spread of fire. Building codes and regulations often require specific fire resistance ratings for walls, floors, doors, and other building components.

It is important to note that fire resistance ratings do not guarantee that a building or assembly will remain completely intact during a fire, but they do provide an important measure of safety and protection.

To learn more about fire resistance rating

https://brainly.com/question/28131933

#SPJ4

Makenna, the outside sales rep for a brick and stone company, reads a report stating that building permits are down dramatically in her sales territory. She had noticed that things were slowing down, but now she has data confirming her impression. Based on this information, Makenna will help her company become more value-driven if she Multiple Choice advises the production and purchasing departments to produce or order smaller quantities of products. keeps the information to herself. avoids contact with competing firms in order to maximize value-driven marketing. pushes her customers to buy products whether they need them or not.

Answers

Given that things were slowing down in the organization, the company would be more value driven if she advises the production and purchasing departments to produce or order smaller quantities of products.

How is a company value driven?

A company is said to be value driven if there is a conscious commitment in the  organization by the heads of departments to create a corporate culture.

The culture that would be created here is one that would lead to better performance, ethical practice and good impact on the environment.

Read more on company culture here:

https://brainly.com/question/16049983

United Supply has a $20 million liability at December 31, 2021, of which $4 million is payable in each of the next five years. United Supply reports the liability in the balance sheet as a:

Answers

Serían 800,00 por año

Research Your Comic Strip
When you are thinking about which careers you would like to pursue, it can be helpful to find out what a typical day in a certain job is like. For this assignment, you will create a “day in the life” comic strip that shows the job duties of someone who has a job in operations management.

“But I’ve never worked in any of those jobs,” you might say. You can research one of those jobs in one or more ways:

Think about what you learned in the unit.
Use some of the research you completed in Activity 1, if you completed that activity.
Interview a friend, family member, or neighbor who has had a job in some type of operations management.
Use different browsers and search engines to find information. For example, you might use search terms such as “quality control manager day in the life” or “purchasing agent everyday tasks.”
You will probably have to use more than one research method to get the information you need.

Step 2: Rough Out Your Script
Most comic book artists create a script before they begin drawing. Here are some steps to help you.

Think about what you have learned.
Put the tasks in time order: What happens early in the workday, in the middle of the day, and before the person leaves work?
Will your comic include dialogue? That means words spoken between people.
What terminology does someone in this job use? Decide whether you will use it in your comic.
What are the most important things you want your reader to know about this job?
Step 3: Draw Your Comic
Now that you know what information you want to include and in what order, start drawing your comic. Don’t worry about being a great artist. You can use stick figures if you want to. Just make sure a reader can understand the sequence of events and learn about this career path.

You can create your comic by folding a piece of paper into sections (one section per panel) or by using illustration software or presentation software (one screen or one slide per panel). If you draw your comic, take a picture of the final comic and submit the image.

Submit your comic to the dropbox.

Answers

Answer:

"Comics" is used as a non-count noun, and thus is used with the singular form of a verb, in the way the words "politics" or "economics" are, to refer to the medium, so that one refers to the "comics industry" rather than the "comic industry".
"Comic" as an adjective also has the meaning of "funny", or as pertaining to comedians, which can cause confusion and is usually avoided in most cases ("comic strip" being a well-entrenched exception).

Explanation:

Comic strip conversations are a technique developed by Carol Gray to help people with autism develop greater social understanding. Comic strip conversations provide visual representations of the different levels of communication that take place in a conversation, using symbols, stick figure drawings and colour.


Comic books also provide authentic material to depict how grammar is used in conversations as opposed to sentences without background. They are funny and will engage the students. It also promotes learning different cultures as comic books are used across the world which will further boost vocabulary.


So let's focus first on the five features that are probably the most important: image style, words and word containers, word-image relationships, undrawn inferences, and layout. You can spend hours exploring them, but here's a brief introduction to each.

1. Buyers, sellers, and producers all have someone else they are competing with for economic benefits. This is known as:
O competition
O monopoly
O collusid
O cartels

Answers

Answer:monopoly

Explanation:

In the long run, which statement is true for a monopolistically competitive firm?
a. The firm's demand curve is highly inelastic. b. Price is equal to marginal cost. c. Price is greater than marginal cost.
d. The firm earns an economic profit.

Answers

In the long run, a monopolistically competitive firm will see that d. The firm earns an economic profit.

What happens in the long run for monopolistically competitive firms ?

A monopolistically competitive firm would be one that produces a good that may be similar to other goods in the industry, but is differentiated such that it is able to control some measure of price from selling something that is a little more unique.

As a result of this control over price, the monopolistically competitive firm can set prices at an amount that will allow them to make an economic profit over the long run.

Find out more on monopolistically competitive firms at https://brainly.com/question/29560552

#SPJ1

Will mark BRAINLIEST!!!

Amanda works as an accountant at a small-sized firm that sends out multiple invoices daily. She wants to ensure that the firm's invoices have a professional look and format. Further, she wants to customize such invoices with the firm's logo. Which accounting program is most suitable for
Amanda's requirements?

A. OpenOffice Calc
В. QuickBooks
C. NetSuite
D. FreshBooks
E. Intact

Answers

Answer:

Netsuite

Hope this answer helps you :)

Have a great day

mark brainliest

After accounting for a sequence of inventory tags, an auditor traces a sample of tags to the physical inventory listing to obtain evidence that all items:______.

Answers

After accounting for a sequence of inventory tags, an auditor traces a sample of tags to the physical inventory listing to obtain evidence that all items represesnted by inventory tags are included in the client's inventory balance.

Inventory or inventory refers to goods and materials held by a company for the ultimate purpose of resale, production or use. Inventory management is a discipline primarily concerned with specifying the shape and placement of stored goods.

Inventory refers to the company's goods and products ready for sale and the raw materials used in their manufacture. Inventory can be categorized in three different ways: raw materials, work in process, and finished goods.

Inventory is an item purchased by a company for resale to its customers. Items can be resold as is or combined into new products.

Learn more about inventory here:brainly.com/question/24868116

#SPJ4

Your journal how does understanding the history of credit make you think differently about credit cards and other forms of debt?

Answers

Understanding credit history allows us to better understand why credit cards and other forms of debt exist and how they have evolved over time.

We can get an overview of how the credit industry has grown, the various regulations that have been put in place to protect consumers, and the various pros and cons of using credit.

Knowing our credit history can help us make more informed decisions about our own use of credit to avoid over-indebtedness and manage our credit responsibly. Understanding our credit history can also help us better understand our rights as consumers so we can make sure we are not taken advantage of by lenders or creditors.

To know more about credit history click here

https://brainly.com/question/1262976

#SPJ4

the percentage of american consumers who regularly attend a church, mosque, synagogue or temple is lower than at any point in history, and continues to fall year-by-year. right now, what is the fastest growing religious affiliation inside the united states?

Answers

the fastest-growing religious affiliation in the United States is the category of "nones," which refers to people who do not identify with any particular religion.

Why it is happening?

According to a 2021 report by the Pew Research Center, the fastest-growing religious affiliation in the United States is the category of "nones," which refers to people who do not identify with any particular religion. This group includes atheists, agnostics, and those who describe their religion as "nothing in particular."

The percentage of U.S. adults who identify as "nones" has been increasing steadily over the past decade and reached a record high of 29% in 2020, up from 17% in 2009. This trend is especially pronounced among younger adults, with 40% of millennials (those born between 1981 and 1996) identifying as "nones" in 2020.

To know more about american consumers visit:

https://brainly.com/question/15240599

#SPJ1

Rising interest rates have made borrowing more costly to consumers. As a result
of the most recent increase in interest rates, borrowing and consumption have
fallen throughout the economy, triggering a contractionary period. Growing
uneasy, citizens have been asking Congress to make an official statement as to
how long this contractionary period is expected to last. Which of the following is
an appropriate response?

Answers

Answer:

it depends on the measures taken to ensure that economy is stable.

Answer:

1. it is difficult to say since contractionary periods have varying lengths in different business cycles.

2. shock

3. high unemployment

4. two

5. expansion stage of the business cycle

Explanation:

just took it

19 The hotel ..... us a special rate because our staff used it on a regular basis.

Answers

The hotel offered us a special rate because our staff used it on a regular basis. The establishment recognized the value of having a loyal and consistent clientele, and as a result, provided a discounted price for our team members.

This arrangement benefits both parties, as the hotel ensures a steady stream of guests, and our staff receives a more cost-effective accommodation option. By maintaining a professional and friendly relationship with the hotel staff, we are able to foster an ongoing partnership, which ensures exceptional service and comfortable stays for our employees. It is quite common for hotels to offer special rates to businesses or organizations whose staff frequently stay at their establishment. This could be because of the potential for a long-term relationship with the business, or simply as a way to show appreciation for the regular patronage. In this particular case, it seems that the hotel has recognized the value of having this group of staff members as regular guests and has extended a special rate to them as a result. It is important to note that the staff members themselves likely had a role in securing this special rate. They may have negotiated with the hotel management or simply expressed their loyalty to the establishment, which could have led to the hotel offering them a discounted rate. Regardless of the specifics, this arrangement can be beneficial for both the hotel and the staff members. The hotel gains regular business and the potential for positive word-of-mouth advertising, while the staff members enjoy a comfortable and convenient place to stay at a reduced rate. Overall, it is a win-win situation for everyone involved.

Learn more about hotel here

https://brainly.com/question/12117796

#SPJ11

Other Questions
What is the name of the line of reflection for the pair of figures? Enter your answer in the box line One number is five less than three times another. If their sum is increased by two, the result is seventeen. Findthe numbers. Use a coordinate grid to write a coordinate proof of the following statement.If the vertices of a triangle are A(0,0), B(2 a, b) , and C(4 a, 0) , then the triangle is isosceles.d. Use your results from parts b and c to draw a conclusion about A B C . _____ refers to euphemisms that deliberately mislead, hide, or evade the truth. This distortion of truth is often found in military, political, and corporate language. After agincourt in 1415, england seemed to be on the verge of complete victory in the hundred years' war becaus:_____ What lessons can the fund management industry learn from theWoodford investment scandal? How many faces does the following shape have? A battery can be used in an an electrical device such as a torch. when the torch is switched on, energy is transferred from the battery to the bulb. what type of energy is transferred to the bulb? Interpret consider the stanza that begins "and this was the way of it," (lines 42-52). who are the two speakers in the stanza, and how do the rhythms of their speech reflect the differences in their attitudes?" We always see the same side of the Moon because a. the Moon does not rotate on its axis. b. the Moon rotates on its axis once for each revolution around Earth. c. when tWe always see the same side of the Moon becausea. the Moon does not rotate on its axis.b. the Moon rotates on its axis once for each revolution around Earth.c. when the other side of the Moon is facing Earth, it is unlit.d. when the other side of the Moon is facing Earth, it is on the opposite side of Earth.e. none of the above It's possible to join, open, close, or reverse a path using the four buttons in the paths section of the pathfinder panel. question 1 options: true false Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X At a water park, rides are labeled based on the number of minutes riders wait in line 7. [15 pts] a recessive lethal allele (a2) has a frequency (q) of 0.05 in newly formed zygotes in generation 0. the locus is in hardy-weinberg equilibrium at the start. a) what is the frequency of the dominant allele? b) what is the frequency of each of the genotypes among the newly formed zygotes? c) what is the fitness of each of the genotypes? d) what is the mean fitness of the population? e) how much will the frequencies of a1 and a2 change after one generation? f) what will be the allele frequencies and the genotype frequencies after generation 1? g) what will be the equilibrium value for a2? Hoskins, Inc. has activity costs of $93,000, a predetermined total overhead of $120,000, an actual overhead of $98,000, and the company has three product lines. The activity rate is ________ per product line. $32,667 $40,000 $31,000 None of the choices are correct. Migration in birds A) allows these organisms to live in favorable climates and use more resources. B) is triggered by external stimuli such as day length. C) is closely linked to reproductive cycles. D) All of the choices are correct. at the end of the project, the total cost of material and labor used for the project was $200,000. the owner paid the contractor $200,000 and in addition to this, the owner paid an amount equal to 10% of $200,000. based on this scenario, what type of contract do you think would the owner and contractor would have entered in at the beginning of the project Consider the 2022 paper "Labour Market Evolutions in Rural Areas" by E. Eser et al. (Mimeo, University of Essex). Summarize the goal of the study, the data and the main findings. what were the cold war fears of the american people in the aftermath of the second world war? how successfully did the administrations of president harry s. truman and dwight d. eisenhower address these fears? Solve for x: 2x + 5 < 7 A:) x > 1B:) x < 1C:) x > 6D:) x < 6Please answer ASAP :]