what is commensalism?​

Answers

Answer 1

Answer:

an association between two organisms in which one benefits and the other derives neither benefits nor harm

Explanation:

A frog using a plant as protection

Answer 2

Answer:commensalism is a symbiotic relationship where one organism benefits and the second is neither harmed nor helped ..

Explanation:


Related Questions

Please help !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Please help !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Your answer should be A Mitosis

Explanation:

Based on what you learned in PBS, what are three foods that would be considered good energy sources? Explain your choices. Bean, nuts, and green vegetables are considered good energy sources. They are high in fiber and low on the glycemic index.

Answers

Based on PBS, the three foods that would be considered good energy sources is bean, nuts, and green vegetables, these foods are recommended as they are high in fiber and low on the glycemic index that increase energy levels.

They are perfect for maintaining energy levels throughout the day without any sudden crashes. Basically, the glycemic index is a scale that ranks foods based on the impact they have on blood sugar levels. Foods that are high on the glycemic index are quickly digested and can cause a rapid increase in blood sugar levels followed by a quick crash. Nuts and beans are low on the glycemic index, and they contain healthy fats and protein, which provide long-lasting energy.

Green vegetables such as spinach, kale, and broccoli are high in nutrients such as iron, which is essential for carrying oxygen to the muscles. This makes them a great source of energy as they help maintain healthy blood flow, reduce inflammation and provide natural fuel to the body. In conclusion, incorporating beans, nuts, and green vegetables into your daily diet is an excellent way to increase energy levels. They provide lasting energy without sudden crashes and are nutrient-dense.

Learn more about glycemic index at

https://brainly.com/question/32417596

#SPJ11

a protein that consists of a single polypeptide chain will lack which level of protein structure?

Answers

A protein that consists of a single polypeptide chain will lack the quaternary level of protein structure. Tertiary structure is the protein's highest level of structural complexity.

The ultimate three-dimensional form of a protein is called its tertiary structure. A single polypeptide chain acts as the backbone of the protein tertiary structure, which may also contain one or more protein secondary structures. The interactions between the R groups of the amino acids that make up the protein are what primarily hold the tertiary structure together.

Polypeptides are formed by combining multiple amino acids to produce proteins. Proteins are created by the joining of two or more polypeptides, which are then folded into the desired shape.

This protein can be found in hair and nails. The sheet with pleats is another common secondary structure.

Through a series of peptide bonds, amino acids come together to create polypeptides, another name for proteins. Which conformation the polypeptide will fold into next is determined by the interactions (dashed lines) between the side chains of the amino acids.

Learn more about Polypeptides here

https://brainly.com/question/28592637

#SPJ11

What are the answers to these?

What are the answers to these?

Answers

A sequence of 3 bases on mRNA is a codonThe structure indicated by the arrow is an amino acidThe structure indicated by the arrow is the anticodonThe role of tRNA is to carry amino acids to the mRNA for correct placement into the protein chain

The translation process

During translation, the sequence of 3 bases on mRNA, otherwise known as codons, are translated into their respective amino acids and linked by peptide bonds to form the primary structure of proteins.

The tRNA carries the anticodon and the amino acids that correspond to each codon on the mRNA. As soon as the anticodon on a particular tRNA matches the codon on the mRNA, the amino acid is dropped and the next codon on the mRNA is read. This cycle continues until the stop codon is reached.

Successive amino acids are linked together by peptide bonds to form proteins.

More on protein sysnthesis can be found here: https://brainly.com/question/29332414

#SPJ1

How are primary and secondary succession similar and how are they different?

Answers

Answer:

Primary and secondary succession occur after both human and natural events that cause drastic change in the makeup of an area. Primary succession occurs in areas where there is no soil and secondary succession occurs in areas where there is soil.

Answer:

Both human and natural activities that result in a substantial change in the composition of an area create primary and secondary succession. In locations where there is no soil, primary succession takes place, and in areas where there is soil, secondary succession takes place.

Explanation:

I'll cashapp you 10$​

I'll cashapp you 10$

Answers

Answer:

The carpal region is distal to the brachial region.

Explanation:

in a two loci system if there is a nonrandom association between allele b and allele a then the population is in linkage disequilibrium.

Answers

Linkage Disequilibrium (LD) is a phenomenon in which alleles at two or more loci are not in random association but are associated in a non-random manner.

It occurs when the alleles of two loci are more likely to be passed together from one generation to the next than expected under random mating. This can happen if two loci are physically close together on the same chromosome and so are more likely to be inherited together.

LD can be used to study the genetic basis of complex traits, as it can point to regions of the genome that may contain genes related to a particular trait. It can also be used to infer the presence of selection and trace the origins of different populations.

In a two loci system, if there is a nonrandom association between allele b and allele a, then the population is in linkage disequilibrium.

know more about Linkage Disequilibrium here

https://brainly.com/question/30885355#

#SPJ11

complete question is :-

in a two loci system if there is a nonrandom association between allele b and allele a then the population is in linkage disequilibrium. Explain.

Which event occurs after Earth’s surface experiences weathering? Wind carries sediments to a new location. Ice forms cracks in large rocks. Moving water breaks sediments into pieces. Surface materials wear down into sediment.

Answers

Answer:

It is A "Wind carries sediments to a new location"

Explanation: Good job to the person above me "claps"

The event which occurs after earth surface experiences new weathering is wind carries sediments to a new location.

What is weathering?

By coming into contact with the Earth's atmosphere, water, and biological organisms, weathering is the process of decomposing rocks, soil, and minerals as well as wood and manmade objects.

Weathering occurs in situ, that is, without much movement and in the same location. It should not be confused with erosion, which is the movement of rocks and minerals caused by natural forces including water, ice, snow, wind, waves, and gravity before being carried away and dumped somewhere else.

Physical weathering and chemical weathering are two significant categories of weathering processes, and each occasionally includes a biological component.

Therefore, The event which occurs after earth surface experiences new weathering is wind carries sediments to a new location.

To learn more about earth surface, refer to the link:

https://brainly.com/question/9382932

#SPJ6

Which factor can cause secondary succession?

clear cutting

glacial melting

competition

predation

Answers

Answer:

first one

Explanation:

clear cutting

Answer:

A

Explanation:

EDGE

which of the following statements is/are correct regarding seed dormancy? I. It is a result of endogenous control.
II. Delayed germination is advantageous to plants.
III. Impermeable and hard seed coat results in the dormancy of the seed.


A
Only II
B
Only III
C
I and III
D
I, II and III

Answers

The correct answer is option (C) "I and III."

Both statements I and III are correct regarding seed dormancy. Statement II is incorrect.

Statement I states that seed dormancy is a result of endogenous control, which is true. Endogenous factors within the seed, such as hormones and genetic mechanisms, regulate the dormancy period and prevent germination until certain conditions are met.

Statement II suggests that delayed germination is advantageous to plants. However, this statement is incorrect. Delayed germination is not universally advantageous to plants. While some seeds may benefit from delayed germination to ensure favorable environmental conditions for growth and survival, other seeds may have evolved strategies for immediate germination. The advantage of delayed germination depends on the specific ecological context and the species involved.

Statement III states that an impermeable and hard seed coat results in the dormancy of the seed, which is true. A hard and impermeable seed coat can prevent water uptake and gas exchange, thus inhibiting germination. This dormancy mechanism ensures that the seed remains dormant until conditions are favorable for germination, such as sufficient moisture, temperature, or light.

In conclusion, statements I and III are correct regarding seed dormancy. Seed dormancy is controlled by endogenous factors, and an impermeable and hard seed coat can contribute to the dormancy of the seed. However, statement II, suggesting that delayed germination is advantageous to plants, is incorrect.

To learn more about seed dormancy visit: brainly.com/question/28744090

#SPJ11

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Which process turns glucose into energy?

Breathing
Cell division
Cellular respiration
Photosynthesis

Answers

Answer:

cellular respiration

Explanation:

cellular respiration

the primary reason steroid hormones usually act slowly is that . the primary reason steroid hormones usually act slowly is that . they are produced at very low concentrations acting via a signal transduction pathway makes for slower responses than does directly interacting with a cell's dna they are too large to enter a cell and therefore must first bind to a plasma membrane receptor before having an effect on a cell target cells tend to ignore steroid hormones in favor of nonsteroid hormones they turn genes on or off and it takes time for gene products to build up or become depleted

Answers

Primary reason steroid hormones usually act slowly is that e. they turn genes on or off and it takes time for gene products to build up or become depleted.

Primary reason why steroid hormones usually act slowly is that they turn genes on or off and it takes time for gene products to build up or become depleted. The receptors for steroid hormones tend to be cytoplasmic proteins that also serve as transcription factors which also requires them to enter the nucleus.

Steroids can also act very quickly, by binding to cell surface receptors, or slowly, by binding to cytoplasmic or nucleic receptors and ultimately activate gene transcription.

To learn more about steroid hormones , here

brainly.com/question/29382368

#SPJ4

Which of the following statements is true?

Carnivores get their energy directly from the sun.
Decomposers add nutrients back to the soil.
Cacti are found in the tropical rainforest.
All food chains start with the consumer.

Answers

Answer:

Decomposers add nutrients back to the soil.

Explanation:

I think this is correct. Because carnivores get their energy primarily from meat. Cacti are primarily found in a desert biome or hot biome. All food chains start with a plant or producer that then gets eaten by a herbivore.

Lystrosaurus probably couldn’t swim very far. How might the locations of lystrosaurus fossils be seen as evidence that the continents were once together?.

Answers

Answer:

Lystrosaurus was found on multiple continents and couldn't swim. So, it is likely that instead if the dinosaur swimming to other continents the continents instead split.

The fossils of Lystrosaurus which cannot swim were found in India, Antarctica and South Africa suggesting the continents were once together.

What do you mean by fossils?"A fossil is any preserved remains, impression, or trace of any once-living thing from a past geological age."Examples: bones, shells, hair, etc.,What are Lystrosaurus ?"Lystrosaurus is an extinct genus of herbivorous from the late Permian and Early Triassic epochs."Its fossils were found in China, India, South Africa and Antarctica.It cannot swim.

Hence, locations of Lystrosaurus fossils can be seen as evidence that the continents were once together because the Lystrosaurus cannot swim but remains are found across the oceans.

To know more about Lystrosaurus here

https://brainly.com/question/18373262

#SPJ2

emerging viruses arise by * 5 points a) mutation of existing viruses. b) the spread of existing viruses to new host species. c) the spread of existing viruses more widely within their host species. d) all of the above

Answers

The emergence of new viruses can occur through a variety of mechanisms. Therefore, the correct answer is (d) all of the above.

What is emerging viruses ?

Emerging viruses are viruses that have recently appeared or are rapidly increasing in incidence or geographic range. These viruses are often new strains or variants of known viruses that have mutated or evolved to become more virulent, infectious.

Emerging viruses can pose significant public health threats, as they often have no known treatments or vaccines and can rapidly spread from person to person.

Therefore, the correct option is D

Learn more about emerging viruses here : brainly.com/question/17173059

#SPJ1

Which liquid is the most Which liquid is the most viscous?

syrup
water
milk
apple juice

Answers

Syrup is mainly more viscous than these three because of its high density.

80 POINTS
-----------------
please help me and i will give brainliest

80 POINTS-----------------please help me and i will give brainliest

Answers

Explanation:

Interphase

number of cells- two new

two new

number of chromosomes- 46 chromosomes

number of homologous- 23 pairs of homologues

After cells have finished dividing their chromosomes, and cytokinesis has divided the cell membrane, the two new cells enter the first stage of interphase,

Cytokinesis

number of cells- two daughter cells

Cytokinesis is the physical process of cell division, which divides the cytoplasm of a parental cell into two daughter cells.

Answer:.

Explanation:

.

if θ2 = 17.1 ∘ , what is the refractive index n of the transparent slab? n = nothing

Answers

The refractive index of the transparent slab is approximately 1.726.

To determine the refractive index of the transparent slab, we can use Snell's law, which relates the angles of incidence and refraction to the refractive indices of the media involved.

Snell's law states:

n₁ × sin(θ₁) = n₂ × sin(θ₂)

where

n₁ = refractive index of the incident medium

θ₁ = angle of incidence

n₂ = refractive index of the refracted medium (transparent slab)

θ₂ = angle of refraction

In this case, we have the following values:

θ₁ = 35.5°

θ₂ = 17.1°

Let's assume the incident medium has a refractive index of n₁ = 1 (usually air).

Using Snell's law, we can rearrange the equation to solve for the refractive index of the transparent slab (n₂):

n₂ = n₁ × sin(θ₁) ÷ sin(θ₂)

Substituting the values, we get:

n₂ = 1 × sin(35.5°) ÷ sin(17.1°)

Calculating this expression:

n₂ = 1.726

To learn more about refractive follow the link:

https://brainly.com/question/30761100

#SPJ4

The complete question is:

Take θ₁ = 35.5 ∘, and if θ₂ = 17.1∘∘, what is the refractive index n of the transparent slab?

what term is used in both the lymphatic and circulatory systems? artery capillary vein aorta

Answers

The term that is used in both the lymphatic and circulatory systems is a vein. So the correct option is (C)

What is the lymphatic system?

The lymphatic system is a network of vessels, nodes, ducts, and organs that help the body fight disease and infection.

What is the circulatory system?

The circulatory system is made up of the heart, blood vessels, and blood. The system transports nutrients, gases, hormones, and wastes around the body.

What is the difference between the circulatory and lymphatic systems?

The primary function of the circulatory system is to transport blood, while the lymphatic system helps maintain fluid balance, transports fats from the digestive system, and defends the body against infection.                                                                                                                                                                                                                                                                  In the circulatory system, blood flows through the heart, arteries, veins, and capillaries, while the lymphatic system has a network of lymph vessels and lymph nodes.

The lymphatic system joins the circulatory system by returning fluid to the bloodstream through veins and subclavian lymphatic ducts. The bloodstream carries lymph to the subclavian veins, where it returns to the circulatory system. Thus, veins are used in both the lymphatic and circulatory systems. Therefore the correct option is (C)

To learn m ore about circulatory systems visit

https://brainly.com/question/29259710

#SPJ11

The full question is given below

content loaded

what term is used in both the lymphatic and circulatory systems?

(a) artery

(b) capillary

(c) vein

(d) aorta

The term used in both the lymphatic and circulatory systems is a vein. Here option C is the correct answer.

The lymphatic system is a part of the body's immune system. It includes a network of lymph vessels that transport a fluid called lymph to various parts of the body. Lymph fluid circulates through the body similarly to blood, but it does not circulate through the arteries.

The lymphatic system also includes lymphoid tissue and organs like the spleen, thymus, tonsils, and adenoids. The circulatory system is the body's transport system. It's made up of a complex network of blood vessels and the heart.

The circulatory system transports oxygen, nutrients, and hormones throughout the body's tissues and organs. It also removes carbon dioxide and waste products, ensuring the proper functioning of all organs and tissues.

The circulatory system is divided into two major parts: the cardiovascular system and the lymphatic system. The cardiovascular system is made up of the heart, blood vessels, and blood.

The lymphatic system is a network of vessels that helps fight infections and remove waste. Therefore option C is the correct answer.

To learn more about vein

https://brainly.com/question/393019

#SPJ11

Complete question:

What term is used in both the lymphatic and circulatory systems?

A - artery

B - capillary

C - vein

D - aorta

Which of the following are gene products?

mRNA
tRNA
tRNA synthetase
promoter
allele
nucleic acid

Answers

Answer:

I think its tRNA

Explanation:

What is the yield to maturity of a 5% coupon, $1000 par value 20
years to maturity bond trading at $1077.00?

Answers

The yield to maturity of the bond is approximately 3.95%.

The yield to maturity (YTM) is the total return anticipated on a bond if held until its maturity date. It represents the average annual return earned by an investor who buys the bond at its current market price and holds it until maturity.

To calculate the yield to maturity, we need to solve the equation using the bond's coupon, par value, time to maturity, and market price. In this case, the bond has a 5% coupon rate, a $1000 par value, 20 years to maturity, and is trading at $1077.00.

Using a financial calculator or spreadsheet software, we can plug in these values to calculate the YTM. The YTM for the given bond comes out to be approximately 3.95%.

This means that if an investor purchases the bond at the current market price of $1077.00 and holds it until maturity, they can expect an average annual return of around 3.95% on their investment.

To learn more about yield to maturity, here

https://brainly.com/question/33763413

#SPJ4

What is the atomic packing factor for the bcc crystal structure?.

Answers

The atomic packing factor(APF) is an indication of how closely atoms are packed together in a solid material. BCC, or body-centered cubic, is a crystal structure with an atomic packing factor of 0.68. This means that 68% of the available space in the unit cell is occupied by atoms.

The atomic packing factor (APF) is used to describe the relationship between the volume of atoms and the volume of a cell in a crystal structure. This term is often used in materials science to understand how tightly atoms are packed together in a solid material. BCC is a crystal structure with an atomic packing factor of 0.68. This means that 68% of the available space in the unit cell is occupied by atoms.
The body-centered cubic (BCC) structure is one of the most common crystal structures in metals. It is found in many pure metals, such as iron, chromium, tungsten, and molybdenum, as well as in some alloys. The BCC structure has a simple cubic lattice with an additional atom located at the center of the cube. This structure is characterized by eight atoms at the corners of the cube and one atom at the center of the cube.


In conclusion, the atomic packing factor for the bcc crystal structure is 0.68. This means that 68% of the available space in the unit cell is occupied by atoms. The body-centered cubic (BCC) structure is a common crystal structure found in many pure metals and some alloys. It is characterized by eight atoms at the corners of the cube and one atom at the center of the cube. The BCC structure has a simple cubic lattice with an additional atom located at the center of the cube.

To know more about crystal structures visit:

brainly.com/question/13647499

#SPJ11

The atomic packing factor (APF) is defined as the ratio of the total atomic volume to the unit cell volume. The atomic packing factor for the bcc crystal structure is 0.68.

In a body-centered cubic (bcc) crystal structure, there are 2 atoms at the corners of the cube, and 1 atom at the center of the cube. The APF for a bcc crystal structure can be determined by calculating the volume of all the atoms in a unit cell and dividing it by the volume of the unit cell. The atomic packing factor for the bcc crystal structure is 0.68.The atomic packing factor (APF) is the ratio of the total atomic volume to the unit cell volume. The APF provides information about how much space in a crystal is occupied by atoms. For example, if the APF is high, it means that the crystal structure is densely packed with atoms.In a body-centered cubic (bcc) crystal structure, there are 2 atoms at the corners of the cube, and 1 atom at the center of the cube. To calculate the APF for the bcc crystal structure, we need to determine the volume of all the atoms in a unit cell and divide it by the volume of the unit cell. Since there are 3 atoms in a bcc unit cell, we need to determine the volume of each atom and multiply it by 3. The volume of a sphere can be calculated using the formula V = (4/3)πr³, where V is the volume and r is the radius of the sphere.For the bcc crystal structure, the APF is calculated as follows:APF = (Volume of atoms in a unit cell) / (Volume of the unit cell)APF = (3 × (4/3)πr³) / (a³)Where a is the length of the cube edge.Since the radius of the bcc atom is (a/2)√3, we can substitute this value into the above equation to get:APF = (3 × (4/3)π(a/2)³√3) / (a³)APF = (3 × (π√3/8) × a³) / (a³)APF = 3 × π√3 / 8APF = 0.68

The atomic packing factor for the bcc crystal structure is 0.68. This value indicates that the bcc crystal structure is not as densely packed as the face-centered cubic (fcc) crystal structure, which has an APF of 0.74. The bcc crystal structure is commonly found in metals such as iron, tungsten, and chromium.

To know more about face-centered cubic visit:

brainly.com/question/4501234

#SPJ11

heredity and reproductive success quick check 1 of 51 of 5 items question the following table shows data about a population of red pandas. data collected from a red panda population over time generation 1 2 3 4 5 average mass of red panda 4.6 kg 4.6 kg 4.5 kg 4.4 kg 4.3 kg nucleotide diversity in population 0.000625 0.0005575 0.0004255 0.0003523 0.0003523 population size 48 47 44 44 42 deforested land (acres) 150 150 450 4,500 54,000 if you wanted to present evidence that red panda populations were becoming less diverse over time, which choice correctly identifies the independent and dependent variables you would choose to use in your graph? (1 point) responses independent

Answers

The independent variable in this scenario is the generation (i.e., time) and the dependent variable is the nucleotide diversity in the population.

Therefore, a graph that plots nucleotide diversity over time (generation) would be appropriate to present evidence that red panda populations were becoming less diverse over time. To present evidence that red panda populations were becoming less diverse over time, we would need to plot nucleotide diversity over time (generation) in a graph. This would allow us to see how nucleotide diversity changes over time and to determine whether there is a decreasing trend. By identifying the independent and dependent variables appropriately, we can ensure that our graph accurately represents the data and helps to support our conclusion.

To know more about independent variable, here

brainly.com/question/29430246

#SPJ4

The sex cells produced through meiosis each have _____.


a single chromosome from the original cell

one chromosome from each pair in the original cell

half of the chromosome pairs from the original cell

pairs of chromosomes identical to the original cell

Answers

The answer is B! Sex cells come from sexual reproduction meaning they will take a cell from both parents!

Hope this helps! Please give brainliest! ❤️

(7) What type of fossil forms when a buried organism decays or is dissolved, but the original shape is preserved in the sediment? (a) body fossil (b) trace fossil (c) mold fossil (d) cast fossil (8) W

Answers

(7) a fossil that preserves the original shape of an organism in sediment is called a mold fossil, (8) Figure 3 represents a brachiopod, and (9) Fossils are primarily identified based on changes in their morphology. The correct answers are 7. C, 8. C, and 9. A.

(7) The type of fossil that forms when a buried organism decays or is dissolved, but the original shape is preserved in the sediment is called a mold fossil. This type of fossil is formed when the remains of an organism leave an impression or cavity in the surrounding sediment. Over time, minerals fill in the space left by the organism, creating a replica of the original shape. Therefore, The correct answer is option C.(8) To identify which of the figures is a brachiopod, we need to look for specific characteristics of this type of organism. Brachiopods are marine animals that have two shells, and they resemble clams or bivalves. Based on this description, we can determine that Figure 3 is a brachiopod, as it has two shells and the overall shape is similar to that of a clam. Therefore, The correct answer is option C.(9) Fossils are most often identified based on changes in their morphology, which is easily recognizable, even in the field. Morphology refers to the physical shape, structure, and characteristics of an organism. By examining the size, shape, and other visible features of a fossil, scientists can make inferences about its identity and classify it into different groups or species. Therefore, The correct answer is option A.

For more questions on fossils

https://brainly.com/question/21303237

#SPJ8

The correct question would be as

(7) What type of fossil forms when a buried organism decays or is dissolved, but the original shape is preserved in the sediment? (a) body fossil (b) trace fossil (c) mold fossil (d) cast fossil (8) Which of the following is a brachiopod? (a) Figure 1 (b) Figure 2 (c) Figure 3 (d) Figure 4 (9) Fossils are most often identified based on changes in their which is easily recognizable, even in the field (a) morphology (b) DNA (c) domain (d) lifestyle

Which of the following is NOT a way the normal microbiota of the intestine helps to prevent infection?
a. It produces acids that lower the pH of the stomach.
b. It speeds up the process by which microbes are flushed from the digestive tract.
c. It consumes food and occupies space, outcompeting potential pathogens.
d. It generates large quantities of oxygen that kill anaerobic pathogens.

Answers

The correct answer is d, the normal microbiota of the intestine does not generate large quantities of oxygen that kill anaerobic pathogens.

In fact, the normal microbiota of the intestine is mostly anaerobic and does not rely on oxygen for survival. Instead, the normal microbiota of the intestine helps prevent infection by producing acids that lower the pH of the stomach, speeding up the process by which microbes are flushed from the digestive tract, and consuming food and occupying space, which outcompetes potential pathogens. These actions make it difficult for harmful microbes to establish themselves in the intestine, helping to maintain a healthy gut microbiome. It is important to note that disruptions to the normal microbiota, such as from antibiotic use, can lead to an overgrowth of harmful pathogens and increased risk of infection. Therefore, maintaining a healthy gut microbiome is crucial for overall health and disease prevention.

Learn more about microbiota here,

https://brainly.com/question/31830469

#SPJ11

in their experiment, they used a bunsen burner, what source of heat did this simulate from early earth?

Answers

In their experiment, the use of a Bunsen burner simulated heat similar to volcanic activity on early Earth.

The use of a Bunsen burner in the experiment is meant to simulate the heat source resembling volcanic activity that was present on early Earth. Volcanoes played a significant role in shaping the early Earth's environment and influencing the development of life. They released intense heat, gases, and minerals into the atmosphere and oceans.

By using a Bunsen burner, scientists can recreate the heat effects observed in volcanic environments. The burner generates high temperatures and a controlled flame, which can be utilized to study the impact of heat on various materials, reactions, and biological processes.

The experiment aims to understand how the conditions on early Earth, including heat sources like volcanic activity, may have influenced the formation of organic molecules, the origin of life, and the evolution of early organisms. By simulating the heat from early Earth's volcanic activity, researchers can gain insights into the chemical and physical processes that shaped the development of life on our planet.

To learn more about Bunsen burner, here

https://brainly.com/question/743920

#SPJ4


Your sense of touch depends upon:

direct contact
heat
chemical reactions
pain

Answers

Answer:

The answer is direct contact.

Explanation:

Sense of touch have to depends on direct contact.

A change is a single nitrogenous base can cause a mutation called which of the following
A. evolutionary mutation
B. point mutation
C. micromutation
D. zoomatic mutation

Answers

Answer:

The correct answer is - option B. point mutation.

Explanation:

A genetic mutation occurs due to a change in a single nucleotide base, either inserted or deleted from the genetic material (DNA or RNA) sequence, which represents the mutation called a point mutation.

It can take place by the substitution of the single nucleotide sequence in DNA or RNA in the genome of the organism, it is also known as substitution mutation.

Sickle cell anemia is an example of the point mutation that takes place due to a change in a single nucleotide sequence.

Other Questions
For what values of x do the following power series converge? (i.e. what is the Interval of Convergence for each power series?) [infinity] (x + 1) / n4 Write the following as an algebraic expression. Then simplify.The total amount of money (in cents) in x quarters, (x+2) dimes, and 2x nickels. (Hint: The value of a quarter is 25 cents, the value of a dime is 10 cents, and the value of a nickel is 5 cents.)HELP PLEASEEE ! In finland , during what season does the weather get cool and wet? please help me im really stuck and tryna finish this Help with this question plz What kind of clean technology does the picture above show?a.Solarc.Recyclablesb.Windd.HydropowerPlease select the best answer from the choices providedABCD what is the behaviour provision for doubtful debts in P & L account help me please and thank you 458. Which of the following intelligence communities is responsible for providing intelligence support inareas such as human factors analysis, counterterrorism, personal recovery, and noncombatantevacuation operations?a)Defense Intelligence Agency (DIA)b)National Security Agency (NSA)c)Central Intelligence Agency (CIA)d)Central Security Service (CSS) What is language and description that appeals to the five senses smell sight taste touch and hearing? Which of the following was a direct result of John Muir's activist works?the passing of the National Parks Billthe end of the logging industrythe establishment of the World Wildlife Fundthe creation of Yosemite National Park Explain how different classes of connective tissues are produced while mentioning all cellular descendant types? Complete the senteces with past simple or past continuousIt. (be) a rainy day of November. We. (come) from school at 2 oclock. We. (not be) very hungry but we. (be) too cold. While we. (walk) with my umbrella, we. (find) a coin. It. (not be) a normal coin, it. (be) a strange coin. We. (not continue) walking. We. (be) a bit nervous. What should we do? Maybe, we ______ to (have) put the coin where we ______ (find) it. We _____ (do) this. We ________ (walk) on the street, when a tall man ______ (ask) us for the coin. We ______ (tell) him that the coin _____ (be) at the beginning of the street. We _________ (know) what ______________ (happen), so we ________ (continue) walking What animal was used to symbolize Russia? What allows ships to move between elevations in the Panama Canal? A. elevators B. canals C. locks D. intercoastal waterways Please select the best answer from the choices provided A B C D 2. Describe how baking cake is an example of irriversible change. Which graph represents the solution set of this inequality?- 2x + 7 < 23Please help Alfred Wegener believed that all of the continents were originally: a. a single landmass called Pangaea c. three landmasses called Europe, Asia, and Gondwana b. two landmasses called Eurasia and Gondwana d. none of the above 20 % of 2 is equal toA. 20B. 4C. 0.4D. 0.04If Log 4 (x) = 12, then log 2 (x / 4) is equal toA. 11B. 48C. -12D. 22 The function g(x) is a transformation of the quadratic parent function, fx):What function is g(x)?90x)15(x)A. g(x) = 4xOB. g(x) = ->O c. g(z) = -1D. g(x)=-4x